A reverse genetics and genomics approach to gene paralog function and disease: Myokymia and the juxtaparanode

Oligodendrocyte-derived LGI3 and its receptor ADAM23 organize juxtaparanodal Kv1 channel clustering for short-term synaptic plasticity

“…During the revision of this article, another related paper was published in which LGI2/3-ADAM23 regulates juxtaparanodal Kv1 channel clusters and the refractory period in myelinated axons in the peripheral sciatic nerve and spinal cord. 72 Given that biallelic LGI3 pathogenic variants cause peripheral nerve hyperexcitability as well as moderate ID, 73 these studies are well complementary to each other, providing the potential PNS and CNS pathogenic mechanisms. Clarifying the whole picture of LGI-ADAM-family-related neurological/brain disorders will contribute to discovering additional molecular pathways for brain functioning and therapeutic strategies.…”

“…In this study, significant behavioral phenotypes were not detected in Lgi3 KO mice, although a recent genetic study in humans reported that 16 individuals with loss-of-function variants in LGI3 from eight families display peripheral nerve hyperexcitability syndrome accompanied by mild or moderate ID with complete penetrance. 73 Three possibilities are considered for this discrepancy. First, behavioral paradigms tested were not sensitive enough to detect subtle, mild cognitive abnormalities.…”

“… 78 N/A Mouse: Rosa26 -LSL-Cas9 knock-in The Jackson Laboratory Cat# 026175; RRID: IMSR_JAX:026175 Mouse: Rosa26 -L-Cas9 knock-in This paper N/A Mouse: Lgi3 -LoxP Marafi et al. 73 MGI: 7331635 Mouse: Mbp -Cre transgenic RIKEN BRC Niwa-Kawakita et al. 79 Cat# RBRC01461 Oligonucleotides Primers for Lgi3-FH knock-in mouse genotyping: Forward: GGCGACAGAAATTTGTACGGTTC Reverse: CCAGGCCCACTTCTTTGTG This paper N/A Primers for Lgi3 knockout mouse genotyping: Forward: GTTCTCAGAAACAGTTTGTGGCTC Reverse: CCACTTCTTTGTGTATGTGTGTG This paper N/A Primers for LGI1 knockout mouse genotyping: WT Forward: CAGATCCTTTGTGAGATCTGGTT KO Forward: AGCGCATCGCCTTCTATCGCCTTC Common Reverse: AGAAGGCTTATCCGAATACATGCC Fukata et al.…”

Functional genomics and small molecules in mitochondrial neurodevelopmental disorders

“…In contrast, the study of rare genetic variation has only just begun. An explosion of neurodevelopmental disease-gene associations has resulted from family-based studies, next generation sequencing, and online gene matchmaking [ 4 , [111] , [112] , [113] , [114] , [115] , [116] , [117] , [118] , [119] , [120] , [121] , [122] , [123] , [124] , [125] , [126] , [127] , [128] ], but genome-wide functional annotation requires greater international integration of human genomic and phenotypic data. National programs like UK Biobank and All of Us represent an important step in this direction [ 129 , 130 ], but a wealth of genomic and phenotypic data remains locked away in data silos: research databases, clinical diagnostic laboratories, and electronic health records.…”

Next-generation phenotyping integrated in a national framework for patients with ultra-rare disorders improves genetic diagnostics and yields new molecular findings

“…A total of 17 candidate genes with high evidence are currently undergoing further investigation, mostly within the framework of international projects. A total of 17 genes (12 associated with autosomal dominant inheritance, 5 with autosomal recessive inheritance) have subsequently acquired DGG status through international cooperation [20][21][22][23][24][25][26][27][28][29][30][31][32] . In comparison with pathogenic variants in previously known disease-associated genes, the present candidate gene set showed a higher proportion of missense variants.…”