A reporter gene assay for fungal sterol biosynthesis inhibitors

Dixon, Graham K.; Scanlon, David; Cooper, Simon; Broad, Peter

doi:10.1016/s0960-0760(97)00032-0

Cited by 15 publications

(7 citation statements)

References 21 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…A reporter gene construct was generated by ligating oligonucleotides representing 3 tandem repeated consensus Nurr1 binding sites (NurRE), into the SpeI/AflII site of the SW-gal construct as previously described [ 21 ], to generate the construct: pNurRE3gal. The sense strand oligonucleotides (5'-3') for the insert were as follows, 3XNurRE: ctagtgtgacctttattctcaaaggtcagtgacctttattctcaaaggtcagtgacctttattctcaaaggtcac.…”

Section: Methodsmentioning

confidence: 99%

Nurr1 dependent regulation of pro-inflammatory mediators in immortalised synovial fibroblasts

et al. 2005

View full text Add to dashboard Cite

BackgroundNurr1 is an orphan member of the nuclear receptor superfamily; these orphan receptors are a group for which a ligand has yet to be identified. Nurr1 has been shown to regulate the expression of a small number of genes as a monomeric, constitutively active receptor. These Nurr1 regulated genes are primarily associated with dopamine cell maturation and survival. However, previous reports have shown an increased expression of Nurr1 in the synovium of patients with rheumatoid arthritis (RA) suggesting a pro-inflammatory role for Nurr1 in RA. In this study we investigate the potential pro-inflammatory role of Nurr1 by monitoring Nurr1 dependent gene expression in an immortalised synoviocyte cell line, K4IM.MethodsWe overexpressed the wild type and a dominant negative form of the orphan nuclear receptor Nurr1, in a model synoviocyte cell line. Using the Affymetrix HG-U133 Genechips we demonstrate the effects on the transcriptome by the receptor. Further evidence of gene expression change was demonstrated using quantitative RT-PCR and ELISA analysis.ResultsWe show that Nurr1 regulates transcription of a small number of genes for pro-inflammatory modulators of which the most significant is interleukin-8 (IL-8). We also demonstrate increased synthesis and secretion of IL-8 further supporting a role for Nurr1 in inflammatory signalling pathways.ConclusionUsing microarray analysis we show that elevated levels of Nurr1 leads to increased gene expression of pro-inflammatory genes: IL-8, Amphiregulin and Kit ligand in a model cell line. This data provides further evidence for an additional role for Nurr1 in inflammation and may play a role in the pathogenesis of rheumatoid arthritis.

show abstract

Section: Methodsmentioning

confidence: 99%

Nurr1 dependent regulation of pro-inflammatory mediators in immortalised synovial fibroblasts

et al. 2005

View full text Add to dashboard Cite

show abstract

“…In S. cerevisiae the product of this gene may be involved in sensing ergosterol levels in the plasma membrane to allow adjustment of ergosterol biosynthesis to match the growth conditions (15). Inhibition of sterol biosynthesis results in increased levels of transcription of some of the genes linked to this pathway, presumably as a result of feedback control (5).…”

Section: Homolog Of Sc Osm1mentioning

confidence: 99%

Genomic Profiling of the Response of Candida albicans to Itraconazole Treatment Using a DNA Microarray

Backer

Ilyina

Ma³

et al. 2001

Antimicrob Agents Chemother

204

143

View full text Add to dashboard Cite

The application of genome-wide expression profiling to determine how drugs achieve their therapeutic effect has provided the pharmaceutical industry with an exciting new tool for drug mode-of-action studies. We used DNA chip technology to study cellular responses to perturbations of ergosterol biosynthesis caused by the broad-spectrum antifungal agent itraconazole. Simultaneous examination of over 6,600 Candida albicans gene transcript levels, representing the entire genome, upon treatment of cells with 10 M itraconazole revealed that 296 genes were responsive. For 116 genes transcript levels were decreased at least 2.5-fold, while for 180 transcript levels were similarly increased. A global upregulation of ERG genes in response to azole treatment was observed. ERG11 and ERG5 were found to be upregulated approximately 12-fold. In addition, a significant upregulation was observed for ERG6, ERG1, ERG3, ERG4, ERG10, ERG9, ERG26, ERG25, ERG2, IDII, HMGS, NCP1, and FEN2, all of which are genes known to be involved in ergosterol biosynthesis. The effects of itraconazole on a wide variety of known metabolic processes are discussed. As over 140 proteins with unknown function were responsive to itraconazole, our analysis might provide-in combination with phenotypic datafirst hints of their potential function. The present report is the first to describe the application of DNA chip technology to study the response of a major human fungal pathogen to drug treatment.

show abstract

“…The results revealed a global upregulation of sterol metabolism genes, including gene ERG24, ERG5, and ERG11, which is consistent with previous reports [22,23] . This was presumed as a result of feedback control [24] . However, which mechanism is responsible for the global upregulation of sterol metabolism genes in response to ergosterol biosynthesis inhibitors remains unclear.…”

Section: Discussionmentioning

confidence: 99%

2-Amino-nonyl-6-methoxyl-tetralin muriate inhibits sterol C-14 reductase in the ergosterol biosynthetic pathway

et al. 2009

View full text Add to dashboard Cite

Aim: To investigate the action mechanism of a novel chemical structural aminotetralin derivate, 2-Amino-Nonyl-6-Methoxyl-Tetralin Muriate (10b), against Candida albicans (C albicans) in the ergosterol biosynthetic pathway. Methods: Antifungal susceptibility test of 10b was carried out using broth microdilution method, the action mechanism of 10b against C albicans was investigated by GC-MS spectrometry and real-time RT-PCR assay, and cytotoxicity of 10b in vitro was assessed by MTS/ PMS reduction assay. Results: 10b reduced the ergosterol content markedly, and the 50% ergosterol content inhibitory concentration (ECIC 50 value) was 0.08 μg/mL. Although the sterol composition of 10b-grown cells was completely identical with that of erg24 strain, the content of ergosta-8,14,22-trienol in 10b-grown cells was much higher than that in erg24 strain. Real-time RT-PCR assay revealed a global upregulation of sterol metabolism genes. In addition, the 50% inhibitory concentration (IC 50 value) of 10b was 11.30 μg/mL for murine embryonic fibroblasts and 35.70 μg/mL for human normal liver cells. Conclusion: 10b possessed a mode of action different from that of azoles and morpholines, whose targets were sterol C-14 reductase (encoded by ERG24 gene) and sterol C-5 desaturase (encoded by ERG3) related enzyme. Although 10b seemed to reduce MTS/PMS reduction in a dose dependent manner, IC 50 value for mammalian cells was much higher than 50% minimum inhibitory concentration (MIC 50 ) value for C albicans. This indicates that the formulation is preliminarily safe and warrants further study for possible human applications.

show abstract

A reporter gene assay for fungal sterol biosynthesis inhibitors

Cited by 15 publications

References 21 publications

Nurr1 dependent regulation of pro-inflammatory mediators in immortalised synovial fibroblasts

Nurr1 dependent regulation of pro-inflammatory mediators in immortalised synovial fibroblasts

Genomic Profiling of the Response of Candida albicans to Itraconazole Treatment Using a DNA Microarray

2-Amino-nonyl-6-methoxyl-tetralin muriate inhibits sterol C-14 reductase in the ergosterol biosynthetic pathway

Contact Info

Product

Resources

About