A refined, rapid and reproducible high resolution melt (HRM)-based method suitable for quantification of global LINE-1 repetitive element methylation

Tse, M. Yat; Ashbury, Janet E.; Zwingerman, Nora; King, Will D.; Taylor, Stacy; Pang, Stephen C.

doi:10.1186/1756-0500-4-565

Cited by 46 publications

(42 citation statements)

References 54 publications

Supporting

Mentioning

Contrasting

Unclassified

Order By: Relevance

“…Methylation of genomic repeat elements, such as long interspersed nuclear element‐1 (LINE1), have been used as markers of global genomic DNA (gDNA) methylation 8, 28, 29. LINE1 methylation in the peripheral blood was therefore used as an indicator of the efficacy of our 5AZA treatment protocol on DNA methylation in vivo.…”

Section: Methodsmentioning

confidence: 99%

DNA Methyltransferase 1–Dependent DNA Hypermethylation Constrains Arteriogenesis by Augmenting Shear Stress Set Point

Heuslein

Gorick

Song

et al. 2017

JAHA

View full text Add to dashboard Cite

BackgroundArteriogenesis is initiated by increased shear stress and is thought to continue until shear stress is returned to its original “set point.” However, the molecular mechanism(s) through which shear stress set point is established by endothelial cells (ECs) are largely unstudied. Here, we tested the hypothesis that DNA methyltransferase 1 (DNMT1)–dependent EC DNA methylation affects arteriogenic capacity via adjustments to shear stress set point.Methods and ResultsIn femoral artery ligation–operated C57BL/6 mice, collateral artery segments exposed to increased shear stress without a change in flow direction (ie, nonreversed flow) exhibited global DNA hypermethylation (increased 5‐methylcytosine staining intensity) and constrained arteriogenesis (30% less diameter growth) when compared with segments exposed to both an increase in shear stress and reversed‐flow direction. In vitro, ECs exposed to a flow waveform biomimetic of nonreversed collateral segments in vivo exhibited a 40% increase in DNMT1 expression, genome‐wide hypermethylation of gene promoters, and a DNMT1‐dependent 60% reduction in proarteriogenic monocyte adhesion compared with ECs exposed to a biomimetic reversed‐flow waveform. These results led us to test whether DNMT1 regulates arteriogenic capacity in vivo. In femoral artery ligation–operated mice, DNMT1 inhibition rescued arteriogenic capacity and returned shear stress back to its original set point in nonreversed collateral segments.ConclusionsIncreased shear stress without a change in flow direction initiates arteriogenic growth; however, it also elicits DNMT1‐dependent EC DNA hypermethylation. In turn, this diminishes mechanosensing, augments shear stress set point, and constrains the ultimate arteriogenic capacity of the vessel. This epigenetic effect could impact both endogenous collateralization and treatment of arterial occlusive diseases.

show abstract

Section: Methodsmentioning

confidence: 99%

DNA Methyltransferase 1–Dependent DNA Hypermethylation Constrains Arteriogenesis by Augmenting Shear Stress Set Point

Heuslein

Gorick

Song

et al. 2017

JAHA

View full text Add to dashboard Cite

show abstract

“…The HRM assay was carried out using a 7900HT Fast Real-Time PCR System (Life Technologies, Waltham, MA, USA) equipped with the SDS Software (Version 2.4.1) as previously described [43]. The primers were designed using MethPrimer [41] according to previous studies [44] in order to optimize the PCR conditions, and were formulated against the completely methylated sense strand of each sequence. The CpG sites screened and the forward (F) and reverse (R) primers were the following: for IL6 F-5′ TTATGTAGGAAAGAGAATTTGGTTTAG and R-5′ AAAAAATAAAATCATCCATTCTTCAC (5 CpGs); for LINE1 F-5′ GCGAGGTATTGTTTTATTTGGGA and R-5′ CGCCGTTTCTTAAACC (8 CpGs); for SERPINE1 F-5′ TGTGTTTGGTTGTAGGGTTAAGA and R-5′ TTACTTTTCTCCTACCTAAAATTCTCA (7 CpGs); and for TNF F-5′ TTTTGGAAAGGATATTATGAGTATTGA and R-5′ CTAAAACCCTAAAACCCCCCTAT (4 CpGs).…”

Section: Methodsmentioning

confidence: 99%

Low Oxygen Consumption is Related to a Hypomethylation and an Increased Secretion of IL-6 in Obese Subjects with Sleep Apnea-Hypopnea Syndrome

Lopez‐Pascual

Lasa²,

Portillo³

et al. 2017

Ann Nutr Metab

View full text Add to dashboard Cite

Background: Deoxyribonucleic acid (DNA) methylation is an epigenetic modification involved in gene expression regulation, usually via gene silencing, which contributes to the risks of many multifactorial diseases. The aim of the present study was to analyze the influence of resting oxygen consumption on global and gene DNA methylation as well as protein secretion of inflammatory markers in blood cells from obese subjects with sleep apnea-hypopnea syndrome (SAHS). Methods: A total of 44 obese participants with SAHS were categorized in 2 groups according to their resting oxygen consumption. DNA methylation levels were evaluated using a methylation-sensitive high resolution melting approach. Results: The analyzed interleukin 6 (IL6) gene cytosine phosphate guanine (CpG) islands showed a hypomethylation, while serum IL-6 was higher in the low compared to the high oxygen consumption group (p < 0.05). Moreover, an age-related loss of DNA methylation of tumor necrosis factor (B = -0.82, 95% CI -1.33 to -0.30) and long interspersed nucleotide element 1 (B = -0.46; 95% CI -0.87 to -0.04) gene CpGs were found. Finally, studied CpG methylation levels of serpin peptidase inhibitor, clade E member 1 (r = 0.43; p = 0.01), and IL6 (r = 0.41; p = 0.02) were positively associated with fat-free mass. Conclusions: These findings suggest a potential role of oxygen in the regulation of inflammatory genes. Oxygen consumption measurement at rest could be proposed as a clinical biomarker of metabolic health.

show abstract

“…Considering the unmethylated standard (0%) as the reference, difference plots were calculated in order to obtain a linear regression of the standard curves that can be used to quantify methylation (42).…”

Section: Methodsmentioning

confidence: 99%

“…2B) derived from standards run in eight independent experiments were plotted against methylation percentage in order to generate a linear regression (Fig. 2C) (42). The correlation coefficient, R 2 ϭ 0.998, indicates a perfect linearity across 10 and 100% methylation.…”

Section: Analytical Characteristic Of the Hpv16 E2bs Pcr Caski Andmentioning

confidence: 99%

Methylation of Human Papillomavirus Type 16 CpG Sites at E2-Binding Site 1 (E2BS1), E2BS2, and the Sp1-Binding Site in Cervical Cancer Samples as Determined by High-Resolution Melting Analysis–PCR

et al. 2013

View full text Add to dashboard Cite

Certain Alphapapillomavirus species classified as high-risk human papillomaviruses (HR-HPVs) have been recognized as the etiologic factors of invasive cervical carcinoma worldwide (1, 2). HR-HPV infections are frequent in young women but they are generally transient, with an estimated mean duration of incident infection of 16 months (3). Only persistent HR-HPV infections are associated with an increased risk of developing high-grade cervical lesions or cancer of the cervix (4-6). Persistent HR-HPV infections may be associated with microscopic abnormalities called low-grade squamous intraepithelial lesions (LSIL). These LSIL present a high rate of regression following HPV clearance but may progress toward high-grade squamous intraepithelial lesions (HSIL) if HR-HPV infection persists. Upon diagnosis, HSIL are treated mostly by excisional procedures to avoid the risk of progression toward invasive cancer (for a review, see reference 7).Among the HR-HPV types, HPV16 exhibits the highest persistence rate (8). Moreover, HPV16 is associated with an increased risk of developing precancerous and cancerous lesions (9) and is considered the most carcinogenic PV in humans (10). This is probably why HPV16 prevalence increases with the severity of cervical lesions (11), reaching 61% in invasive cervical carcinoma worldwide (12).HPV-associated carcinogenesis requires the continuous overexpression of the two main viral oncoproteins E7 and E6, which interact with many cellular proteins leading to the induction and the maintenance of a transformed phenotype in infected cells (for a review, see reference 13). E7 and E6 expression is regulated by the viral E2 protein through the early promoter (named p97 for HPV16) located in the long control region (LCR) of the PV genome. This promoter harbors four specific E2-binding sites (E2BSs) sharing the consensus sequence 5=-ACCG(N) 4 15). The three sites proximal to the TATA box have been shown to be involved in E2-mediated repression of the promoter activity, and E2BS1 and E2BS2 are probably the main sites to achieve this effect (for a review, see reference 16). From a mechanistic point of view, the binding of E2 to E2BS1 and E2BS2 induces a displacement of transcription activators, such as specificity protein 1 (Sp1) and TATA binding protein (TBP), from their binding sites, leading to a repression of E7 and E6 expression from the early promoter (17, 18). HR-HPV DNA integration has been described as a key step in the carcinogenesis process, since it generally results in the disruption of the E2 open reading frame (ORF) (19,20).Epigenetic alterations, and particularly aberrant DNA methylation, are frequently associated with tumor progression. Methylation of DNA mainly occurs on cytosines located in CpG dinucle-

show abstract

A refined, rapid and reproducible high resolution melt (HRM)-based method suitable for quantification of global LINE-1 repetitive element methylation

Cited by 46 publications

References 54 publications

DNA Methyltransferase 1–Dependent DNA Hypermethylation Constrains Arteriogenesis by Augmenting Shear Stress Set Point

DNA Methyltransferase 1–Dependent DNA Hypermethylation Constrains Arteriogenesis by Augmenting Shear Stress Set Point

Low Oxygen Consumption is Related to a Hypomethylation and an Increased Secretion of IL-6 in Obese Subjects with Sleep Apnea-Hypopnea Syndrome

Methylation of Human Papillomavirus Type 16 CpG Sites at E2-Binding Site 1 (E2BS1), E2BS2, and the Sp1-Binding Site in Cervical Cancer Samples as Determined by High-Resolution Melting Analysis–PCR

Contact Info

Product

Resources

About