A pseudoknot-like structure required for efficient self-cleavage of hepatitis delta virus RNA

Abstract

Hepatitis delta virus genomic and antigenomic RNAs contain a self-cleavage site hypothesized to function in processing the viral RNA during replication. Self-cleavage requires only a divalent cation and is mediated at the genomic site by a sequence of less than 85 nucleotides. We propose that the genomic self-cleaving sequence element and a corresponding sequence from the anti-genomic RNA could generate related secondary structures. The region of the antigenomic sequence, predicted from the proposed structure, was synthesized and shown to be sufficient for self-cleavage. Evidence for two stems which form a tertiary interaction was obtained by site-specific mutagenesis of the antigenomic sequence. Efficient self-cleavage in 10 M formamide or 5 M urea, also a property of the genomic sequence, was dependent on base-pairing in both stems. But in the absence of denaturants, the stem distal to the site of cleavage was not required, suggesting that the tertiary interaction stabilizes the structure required for self-cleavage.

The catalytic domain of human hepatitis delta virus RNA

“…In discriminating among the three proposed models regarding to the secondary structure of HDV RNA we found that the axehead model [4] which contains 11 G-C pairs, one A-U pair, and two G-U pairs (based on our sequence) does not agree with the present NMR results. whilst both the pseudoknot model [3] (Fig. l), which contains 15 G-C pairs and two A-U pairs, and the clover leaf model [2], which contains 13 G-C pairs and 2 A-U pairs, are consistent with our NMR data.…”

“…yielding a 3' cleavage product with a 5' hydroxyl group and a 5' cleavage product with a 9'3'-cyclic phosphoryl group [2]. Several secondary structures have been proposed for genomic HDV RNA, including pseudoknot [3] (Fig. 1).…”

Rescue of Mumps Virus from cDNA

“…The three terminal G residues of the T7 promoter were omitted during construction of the minireplicon to provide a transcriptional start site which began with the precise 5Ј nucleotide of the MUV genome. Inclusion of the HDV ribozyme in the minireplicon construct permitted cleavage of the T7 RNA polymerase transcript to produce the authentic MUV specific 3Ј end (30). The total number of nucleotides (966) in the MUVCAT minireplicon RNA was divisible by 6, in agreement with the "rule of six" proposed for Sendai virus, where it has been suggested that each NP molecule interacts with six nucleotides along the RNA genome, and so genome lengths containing multiples of six nucleotides would be more efficient in replication and rescue (4,22).…”

“…CATTCGTCTCTTTTCCAGGTAGTGTCAAAATGCC for addition of the ribozyme component, which is shown in smaller print (30). The CAT ORF cDNA was amplified using primers 5ЈATCATTCGTCTCGGAAAATGGAGAAAAA AATCACTGGATATACC and 5ЈATCATTCGTCTCTCGATTTACGCCCCG CCCTGCCACTC.…”

Four RNA families with functional transient structures

“…12,[73][74][75] Consistent with this regulatory model, flanking sequences originated from virus and vector have been shown to affect the HDV ribozyme selfcleaving activity. 71,76 The upstream sequence 5 0 to the self-cleavage site could thus be involved in regulating the selfcleavage activity of the HDV ribozyme when the self-cleavage activity is not desired, but the downstream attenuator not readily available. That is, alternative structures formed co-transcriptionally and being mutually exclusive to the active conformation could potentially temporarily adjust the HDV ribozyme activity.…”