A Proposal for Identifying the Short ID Sequence Which Addresses the Plastid Subtype of Higher Plants.

Nakamura, lkuo; Kameya, Nanako; Kato, Yusuke; Yamanaka, Susumu; Jomori, Hiroshi; Sato, Yo Ichiro

doi:10.1270/jsbbs1951.47.385

Cited by 26 publications

(39 citation statements)

References 18 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…We successfully amplified the rps2 gene and the rpl16-rpl14 spacer region from dried samples of three Cistanche species using primers designed on the basis of the tobacco sequence 6) and common primers proposed by Nakamura et al, 5) respectively. Sequencing of the PCR products revealed the presence of intraspecific sequence variations among four samples of C. salsa and three of C. tubulosa.…”

Section: Discussionmentioning

confidence: 99%

“…Rpl16-rpl14 spacer region, containing a part of the rpl16 3Ј exon in this study, was amplified using common primers synthesized according to the sequences of Nakamura et al 5) ( Fig. 1) The phylogenetic relationship of Cistanche deserticola, C. salsa and C. tubulosa was analyzed by comparing the nucleotide sequences of the plastid rps2 gene and the intergenic spacer region between rpl16 and rpl14.…”

Section: Methodsmentioning

confidence: 99%

“…4) In contrast, ribosomal protein subunit 2 (rps2) and ribosomal protein large subunit 16 (rpl16) genes in plastid genome were reported to be not deleted in the nonphotosynthetic holoparasitic plant Epifagus verginiana. 4) In this study, we determined the sequences of rps2 gene and an intergenic spacer region between rpl16 gene and ribosomal protein large subunit 14 (rpl14) gene containing a part of rpl16 gene 3Ј exon (rpl16-rpl14 spacer region) 5) amplified from various Cistanche plants and discussed the classification and the phylogenetic relationship of these plants.…”

mentioning

confidence: 99%

See 2 more Smart Citations

Pharmacognostical Studies of Cistanchis Herba (III) Phylogenetic Relationship of the Cistanche Plants Based on Plastid rps2 Gene and rpl16-rpl14 Intergenic Spacer Sequences.

Tomari

Ishizuka

Moriya

et al. 2002

Biological & Pharmaceutical Bulletin

View full text Add to dashboard Cite

Section: Discussionmentioning

confidence: 99%

Section: Methodsmentioning

confidence: 99%

mentioning

confidence: 99%

See 1 more Smart Citation

Pharmacognostical Studies of Cistanchis Herba (III) Phylogenetic Relationship of the Cistanche Plants Based on Plastid rps2 Gene and rpl16-rpl14 Intergenic Spacer Sequences.

Tomari

Ishizuka

Moriya

et al. 2002

Biological & Pharmaceutical Bulletin

View full text Add to dashboard Cite

“…The SNP (A/T) in PS-ID sequences (Nakamura et al, 1997) was analyzed using dCAPS primers. The nucleotide sequence of each primer was: Psid2F-5' AAAAAAAAACAATTGCAGATTRAATT 3' (R = A or G) and Psid1R-5' AGCATTTAAAAGGGTCTGAGGT 3'.…”

Section: Analysis Of Ps-id and Ccssr7mentioning

confidence: 99%

Molecular Analysis of the Genetic Diversity of Chinese Hami Melon and Its Relationship to the Melon Germplasm from Central and South Asia

Aierken

Akashi

Nhi

et al. 2011

J. Japan. Soc. Hort. Sci.

View full text Add to dashboard Cite

Chinese Hami melon consists of the varieties cassaba, chandalak, ameri, and zard. To show their genetic diversity, 120 melon accessions, including 24 accessions of Hami melon, were analyzed using molecular markers of nuclear and cytoplasmic genomes. All Hami melon accessions were classified as the large-seed type with seed length longer than 9 mm, like US and Spanish Inodorus melon. Conomon accessions grown in east China were all the smallseed type. Both large-and small-seed types were in landraces from Iran, Afghanistan, Pakistan, and Central Asia. Analysis of an SNP in the PS-ID region (Rpl16-Rpl14) and size polymorphism of ccSSR7 showed that the melon accessions consisted of three chloroplast genome types, that is, maternal lineages. Hami melon accessions were T/338 bp type, which differed from Spanish melon and US Honey Dew (T/333 bp type), indicating a different maternal lineage within group Inodorus. The gene diversity (D), calculated from random amplified polymorphic DNA (RAPD) and simple sequence repeat (SSR) polymorphism, was 0.476 in 120 melon accessions; the largest diversity was in Central Asian accessions (D = 0.377) but was low for Hami melon accessions (D = 0.243), even though Hami melon has diverse morphological traits, earliness, and shelf life. Reflecting such small genetic diversity, Hami melon accessions of vars. ameri and zard were grouped into cluster II, except for one accession, by the unweighted pair group method and the arithmetic mean (UPGMA) cluster analysis. Variety chandalak with distinct characters, such as early maturing and poor shelf life, was assigned to clusters IV and VI, indicating inter-varietal genetic differentiation within Hami melon. Three accessions from Turkmenistan and Afghanistan, with large seeds and T/338 bp type of chloroplast genome, were classified as cluster II with Hami melon accessions of vars. ameri and zard. We therefore concluded that Hami melon may have been transmitted from the west. The small-seed type melon of group Conomon grown in east China may have been introduced into China independently of Hami melon, because it had the A/338 bp type of the chloroplast genome and was clustered distantly from Hami melon according to nuclear genome analysis.

show abstract

“…PS-ID is a short sequence which is associated with the plastid subtype of higher plants. Among japonica and indica varieties, two slippages in the A and C tracts were found between their PS-ID by Nakamura et al (1997). In future, the use of plastid DNA should be considered as one of the methods of classification of rice varieties.…”

Section: Identification and Classification Of Indica/japonica Hybridsmentioning

confidence: 99%

Utilization of Diverse Rice Ecotypes in Heterosis Breeding.

Jiang

Sun

et al. 2002

Breed. Sci.

View full text Add to dashboard Cite

A classification based on RFLP markers and morphological trait index was conducted in four photoperiodand/or thermo-sensitive genic male sterile rice (PGMS or TGMS) lines and 49 rice varieties of nine different ecotypic origins. The results indicated that the combination of the two classification methods enabled to classify clearly and similarly the materials into two groups, indica and japonica. The 49 varieties were test-crossed to the four PGMS or TGMS lines used as female parents. Grain yield of the test-crossed F 1 s of diverse ecotypes exhibited remarkable differences, especially in three parameters, i.e. number of combinations over a check, extent of standard heterosis and heterobeltiosis. In general, the first two showed higher values in indica-japonica crosses than in crosses between two different ecotypes within the same subspecies. For each female parent except for LS2S, there were corresponding optimum ecotypes of male parents. In terms of grain yield advantages and above-mentioned parameters, patterns of heterotic combinations were as follows: Peiai64S in combination with japonica varieties of northeastern China, restorers of japonica rice hybrids, or japonica varieties of North China; N422S in combination with indica varieties of China, indica varieties of Korea; 108S with American new varieties, japonica varieties of northeastern China, and indica varieties of China. LS2S showed a lower general combining ability.

show abstract

A Proposal for Identifying the Short ID Sequence Which Addresses the Plastid Subtype of Higher Plants.

Cited by 26 publications

References 18 publications

Pharmacognostical Studies of Cistanchis Herba (III) Phylogenetic Relationship of the Cistanche Plants Based on Plastid rps2 Gene and rpl16-rpl14 Intergenic Spacer Sequences.

Pharmacognostical Studies of Cistanchis Herba (III) Phylogenetic Relationship of the Cistanche Plants Based on Plastid rps2 Gene and rpl16-rpl14 Intergenic Spacer Sequences.

Molecular Analysis of the Genetic Diversity of Chinese Hami Melon and Its Relationship to the Melon Germplasm from Central and South Asia

Utilization of Diverse Rice Ecotypes in Heterosis Breeding.

Contact Info

Product

Resources

About