A Novel GEMIN4 Variant in a Consanguineous Family Leads to Neurodevelopmental Impairment with Severe Microcephaly, Spastic Quadriplegia, Epilepsy, and Cataracts

Hesham, Aldhalaan M.; Al-Bakheet, Albandary; AlRuways, Sarah; Almutairi, Nouf; AlNakiyah, Maha; AlGhofaili, Reema; Cardona‐Londoño, Kelly J.; AlAhmadi, Khalid; AlQudairy, Hanan; Al‐Rasheed, Maha; Çolak, Dilek; Arold, Stefan T.; Kaya, Namik

doi:10.3390/genes13010092

Cited by 6 publications

(6 citation statements)

References 36 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…While the cleft palate, muscle hypotonia, abnormal growth, and some dysmorphic aspects have frequently been described in both conditions [ 2 , 15 ], the scoliosis, the joint laxity, and the hearing loss have been found in only four chromosome 17p13.3 duplication syndrome patients [ 2 ]. Several genes in the 17p13.3 CNV have high pLI values and have been associated with disease when mutated, but, while ABR has been reported as a candidate gene whose aploinsufficiency could cause cleft palate, the pathogenetic variants in other duplicated genes are reported to be causative of recessive diseases [ 2 , 16 , 17 , 18 , 19 ]. Moreover, the patient’s duplication is located distally to the well-known MDS region, making the comparison between her phenotype and those of previously reported 17p13.3 duplication syndrome cases misleading.…”

Section: Discussionmentioning

confidence: 99%

Let Time Teach You: A Case Report of a Double Diagnosis of 17P Duplication and Ehlers-Danlos Syndrome

Castronovo

Aleo

Seresini

et al. 2022

Genes

View full text Add to dashboard Cite

Kyphoscoliotic Ehlers–Danlos syndrome and 17p13.3 microduplication share multiple clinical features such as muscle hypotonia, cleft palate, and growth impairment. This paper describes a patient who was first diagnosed with the duplication and a decade later also with FKBP14-kEDS. The latter was initially overlooked due to the pathogenic significance attributed to the duplication and to the fact that, at the time of the first diagnosis, this specific form of kEDS had yet to be discovered. The patient’s progressive kyphoscoliosis and severe joint laxity were the clinical features that prompted the patient’s physiatrist to reassess the genetic work-up. This extreme latency caused inaccurate management in the patient’s follow-up program, which ultimately may have resulted in preventable clinical complications. This report underlines the importance of remaining up-to-date with patient status, reviewing old cases, and relying on specialist advice to reach a correct diagnosis.

show abstract

Section: Discussionmentioning

confidence: 99%

Let Time Teach You: A Case Report of a Double Diagnosis of 17P Duplication and Ehlers-Danlos Syndrome

Castronovo

Aleo

Seresini

et al. 2022

Genes

View full text Add to dashboard Cite

show abstract

“…Genomic DNA (gDNA) was isolated from blood using a Gentra ® Puregene DNA Purification Kit (Gentra Systems, Inc. Minneapolis, MN, US), according to the manufacturer’s instructions. Whole-exome sequencing (WES) was performed on the patient’s DNA, as described previously ( Aldhalaan et al, 2021 ; Scala et al, 2022 ). To confirm the result, gDNA samples were amplified by PCR using HPRT1-specific primers (forward GTGAAAAGGACCCCACGAAG and reverse CAAATTATGAGGTGCTGGAAGGA).…”

Section: Methodsmentioning

confidence: 99%

Detailed genetic and clinical analysis of a novel de novo variant in HPRT1: Case report of a female patient from Saudi Arabia with Lesch–Nyhan syndrome

Al-Bakheet

AlQudairy²,

Alkhalifah³

et al. 2023

Front. Genet.

Self Cite

View full text Add to dashboard Cite

Background: Hypoxanthine-guanine phosphoribosyltransferase (HPRT1) deficiency is an inborn error of purine metabolism responsible for Lesch–Nyhan syndrome (LNS). The disease is inherited in an X-linked recessive manner and predominantly affects male individuals. Female individuals can carry a mutation as heterozygotes, but typically, they are asymptomatic because of the random inactivation of the affected allele. Nevertheless, although rare, heterozygote female individuals may manifest LNS with full characteristics. Herein, we describe a female patient from Saudi Arabia with LNS.Results: The patient (a 4-year-old girl) presented with typical characteristics of the disease, which include global developmental delay, self-mutilation, hyperuricemia, hypotonia, speech delay, spasticity, and seizures. Her general biochemical laboratory results were normal except for high levels of uric acid. The abdominal MRI\MRS, mostly unremarkable, showed bilateral echogenic foci within the renal collecting system. Genetic testing (whole-exome sequencing, iterative variant filtering, segregation analysis, and Sanger sequencing) pointed a novel de novo frameshift variant in HPRT1. X-inactivation assay using HpaII showed the presence of a 100% skewed X chromosome carrying the affected allele. RT-PCR of the cDNA indicated complete loss of the expression of the normal allele.Conclusion: Our study presents a female patient who has a severe case of LNSand found to be the 15th female patient with the disease in the world. The study emphasizethe need for a streamlined protocol that will help an early and accurate diagnosis of female LNS patients to avoid unnecessary interventions that lead to costly patient care.

show abstract

“…After library preparation, captured fragments were run on an Illumina HiSeq 2500 Sequencer and mapped against UCSC hg19 (Illumina, Inc., San Diego, CA, United States). Comprehensive filtering of the detected variants was done as previously published (8)(9)(10)(11). Especially, variants based on homozygosity, coding, and splicing features, being within the autozygome of the affected individuals in the families, were prioritized during filtering analysis.…”

Section: Whole Exome Sequencingmentioning

confidence: 99%

“…Additionally, publicly available databases and local resources, such as the program for Saudi Human Genome-based data outputs, were also screened during filtering. In silico pathogenicity was carried out as reported before (8)(9)(10)(11).…”

Section: Whole Exome Sequencingmentioning

confidence: 99%

Clinical, radiological, and genetic characterization of SLC13A5 variants in Saudi families: Genotype phenotype correlation and brief review of the literature

AlQudairy

Aldhalaan²,

AlRuways³

et al. 2023

Front. Pediatr.

Self Cite

View full text Add to dashboard Cite

BackgroundSLC13A5 (solute carrier family 13, member 5) encodes sodium/citrate cotransporter, which mainly localizes in cellular plasma membranes in the frontal cortex, retina, and liver. Pathogenic variants of the gene cause an autosomal recessive syndrome known as “developmental and epileptic encephalopathy 25 with amelogenesis imperfecta.”ResultsHere, we have investigated six patients from three different consanguineous Saudi families. The affected individuals presented with neonatal seizures, developmental delay, and significant defects in tooth development. Some patients showed other clinical features such as muscle weakness, motor difficulties, intellectual disability, microcephaly, and speech problems in addition to additional abnormalities revealed by electroencephalography (EEGs) and magnetic resonance imaging (MRI). One of the MRI findings was related to cortical thickening in the frontal lobe. To diagnose and study the genetic defects of the patients, whole exome sequencing (WES) coupled with confirmatory Sanger sequencing was utilized. Iterative filtering identified two variants of SLC13A5, one of which is novel, in the families. Families 1 and 2 had the same insertion (a previously reported mutation), leading to a frameshift and premature stop codon. The third family had a novel splice site variant. Confirmatory Sanger sequencing corroborated WES results and indicated full segregation of the variants in the corresponding families. The patients’ conditions were poorly controlled by multiple antiepileptics as they needed constant care.ConclusionConsidering that recessive mutations are common in the Arab population, SLC13A5 screening should be prioritized in future patients harboring similar symptoms including defects in molar development.

show abstract

A Novel GEMIN4 Variant in a Consanguineous Family Leads to Neurodevelopmental Impairment with Severe Microcephaly, Spastic Quadriplegia, Epilepsy, and Cataracts

Cited by 6 publications

References 36 publications

Let Time Teach You: A Case Report of a Double Diagnosis of 17P Duplication and Ehlers-Danlos Syndrome

Let Time Teach You: A Case Report of a Double Diagnosis of 17P Duplication and Ehlers-Danlos Syndrome

Detailed genetic and clinical analysis of a novel de novo variant in HPRT1: Case report of a female patient from Saudi Arabia with Lesch–Nyhan syndrome

Clinical, radiological, and genetic characterization of SLC13A5 variants in Saudi families: Genotype phenotype correlation and brief review of the literature

Contact Info

Product

Resources

About