A maize α-zein promoter drives an endosperm-specific expression of transgene in rice

Joshi, Jarina; Geetha, S.; Singh, Birla; Kumar, K. K.; Kokiladevi, E.; Arul, L.; Balasubramanian, P.; Sudhakar, D.

doi:10.1007/s12298-014-0268-9

Cited by 10 publications

(5 citation statements)

References 53 publications

(57 reference statements)

Supporting

Mentioning

Contrasting

Order By: Relevance

“…We, therefore, used endosperm-specific promoters such as rice glutelin, a popular endosperm-specific promoter and maize α-zein promoter for driving endosperm-specific expression. Earlier, we have demonstrated that the α-zein promoter isolated from maize could drive endosperm-specific expression in transgenic rice (Joshi et al 2015). For genetic transformation studies, we used a tropical inbred UMI29, which was shown to be amenable to genetic transformation in our laboratory (Joshi et al 2014(Joshi et al , 2016.…”

Section: Discussionmentioning

confidence: 99%

“…The phosphinothricin resistance gene (bar) was used as the plant selectable marker. Maize zein promoter was isolated earlier in our laboratory (Geetha 2011) and its endosperm-specific expression pattern in the rice model system was demonstrated in our laboratory (Joshi et al 2015). The pZSPPHY construct harbours gusA besides phyA gene ( Fig.…”

Section: Plant Expression Vectormentioning

confidence: 96%

See 1 more Smart Citation

Genetic transformation of tropical maize (Zea mays L.) inbred line with a phytase gene from Aspergillus niger

et al. 2019

Self Cite

View full text Add to dashboard Cite

A full-length cDNA of phyA gene of Aspergillus niger, encoding phytase enzyme, was cloned and expressed in E. coli BL21 cells and assayed for its activity. The phyA cDNA consisted of 1404 bp, which encoded 467 amino acid residues. The phytase activity of purified phytase was 826.33 U/mL. The phyA gene under the control of endosperm-specific promoters was transformed into an Indian maize inbred line, UMI29, using particle bombardment-mediated transformation method to generate transgenic maize plants over-expressing phytase in seeds. PCR and GUS analyses demonstrated the presence of transgenes in T 0 transgenic plants and their stable inheritance in the T 1 progenies. Three transgenic events expressing detectable level of A. niger phytase were characterized by western blot analysis. Phytase activity of 463.158 U/kg of seed was observed in one of the events, JB-UMI29-Z17/2. The phytase activity of transgenic maize seeds was 5.5-to 7-fold higher than the wild-type UMI29 seeds and, consequently, the seeds had 0.6-to 5-fold higher inorganic phosphorus content.

show abstract

Section: Discussionmentioning

confidence: 99%

Section: Plant Expression Vectormentioning

confidence: 96%

Genetic transformation of tropical maize (Zea mays L.) inbred line with a phytase gene from Aspergillus niger

et al. 2019

Self Cite

View full text Add to dashboard Cite

show abstract

“…The temporal expression pattern of promoters during seed maturation was also inspected by the histological staining of seed longitudinal sections from each transgenic line (Figure 2b). To monitor promoter activity during endosperm development, GUS staining was performed in the seeds of the early broom stage (4-10 DAF), milky stage (14-15 DAF), soft dough stage (17-18 DAF), hard dough stage (20-23 DAF) and mature stage (>28 DAF) (Joshi et al, 2015), and P OsNETE1 -P OsNETE5 -driven GUS expression was not observed in the endosperm. These results indicated that the five promoters are functional and expressed in a nonendosperm tissue-specific manner, although their strength needs further verification.…”

Section: Analysis Of Promoter Activities In Transgenic Ricementioning

confidence: 99%

Isolation of five rice nonendosperm tissue‐expressed promoters and evaluation of their activities in transgenic rice

et al. 2017

Plant Biotechnology Journal

View full text Add to dashboard Cite

SummaryUsing promoters expressed in nonendosperm tissues to activate target genes in specific plant tissues or organs with very limited expression in the endosperm is an attractive approach in crop transgenic engineering. In this article, five putative nonendosperm tissue‐expressed promoters were cloned from the rice genome and designated PO s NETE 1, PO s NETE 2, PO s NETE 3, PO s NETE 4 and PO s NETE 5. By qualitatively and quantitatively examining GUSplus reporter gene expression in transgenic rice plants, PO s NETE 1‐PO s NETE 5 were all found to be active in the roots, leaves, stems, sheaths and panicles but not in the endosperm of plants at different developmental stages. In addition, PO s NETE 2, PO s NETE 4 and PO s NETE 5 were also inactive in rice embryos. Among these promoters, PO s NETE 4 and PO s NETE 5 exhibited higher activities in all of the tested tissues, and their activities in stems, leaves, roots and sheaths were higher than or comparable to those of the rice Actin1 promoter. We also progressively monitored the activities of PO s NETE 1‐PO s NETE 5 in two generations of single‐copy lines and found that these promoters were stably expressed between generations. Transgenic rice was produced using PO s NETE 4 and PO s NETE 5 to drive a modified Bt gene, mC ry1Ab. Bt protein expressed in the tested plants ranged from 1769.4 to 4428.8 ng/g fresh leaves, whereas Bt protein was barely detected in the endosperm. Overall, our study identified five novel nonendosperm tissue‐expressed promoters that might be suitable for rice genetic engineering and might reduce potential social concern regarding the safety of GMO crops.

show abstract

“…Those promoters responded to several photosystem‐related proteins in the same regions of transgenic switchgrass by fusing with switchgrass MYB4 (Liu et al ., 2018). So far, a number of representative tissue‐ or organ‐specific native promoters have been reported: root‐specific promoters including tomato SIREO and rice RCc3 (Jones et al ., 2008; Xu et al ., 1995), the phloem‐specific promoter of Brassica juncea (Koramutla et al ., 2016), seed‐specific promoters rice glutelin (Wu et al ., 2000), sesame 2S albumin (Bhunia et al ., 2014), corn zein (Joshi et al ., 2015), and bean arcelin (De Jaeger et al ., 2002), and trichome tissue‐specific promoters in mint (Ahkami et al ., 2015; Vining et al ., 2017). A developing xylem (DX) tissue‐specific native promoter was cloned from Pinus densiflora , which was used to enhance plant biomass and produce biofuel precursors (Cho et al ., 2019; Ko et al ., 2012).…”

Section: Introductionmentioning

confidence: 99%

Novel synthetic inducible promoters controlling gene expression during water‐deficit stress with green tissue specificity in transgenic poplar

Yang,

Chaffin,

Shao

et al. 2024

Plant Biotechnology Journal

View full text Add to dashboard Cite

SummarySynthetic promoters may be designed using short cis‐regulatory elements (CREs) and core promoter sequences for specific purposes. We identified novel conserved DNA motifs from the promoter sequences of leaf palisade and vascular cell type‐specific expressed genes in water‐deficit stressed poplar (Populus tremula × Populus alba), collected through low‐input RNA‐seq analysis using laser capture microdissection. Hexamerized sequences of four conserved 20‐base motifs were inserted into each synthetic promoter construct. Two of these synthetic promoters (Syn2 and Syn3) induced GFP in transformed poplar mesophyll protoplasts incubated in 0.5 M mannitol solution. To identify effect of length and sequence from a valuable 20 base motif, 5′ and 3′ regions from a basic sequence (GTTAACTTCAGGGCCTGTGG) of Syn3 were hexamerized to generate two shorter synthetic promoters, Syn3‐10b‐1 (5′: GTTAACTTCA) and Syn3‐10b‐2 (3′: GGGCCTGTGG). These promoters' activities were compared with Syn3 in plants. Syn3 and Syn3‐10b‐1 were specifically induced in transient agroinfiltrated Nicotiana benthamiana leaves in water cessation for 3 days. In stable transgenic poplar, Syn3 presented as a constitutive promoter but had the highest activity in leaves. Syn3‐10b‐1 had stronger induction in green tissues under water‐deficit stress conditions than mock control. Therefore, a synthetic promoter containing the 5′ sequence of Syn3 endowed both tissue‐specificity and water‐deficit inducibility in transgenic poplar, whereas the 3′ sequence did not. Consequently, we have added two new synthetic promoters to the poplar engineering toolkit: Syn3‐10b‐1, a green tissue‐specific and water‐deficit stress‐induced promoter, and Syn3, a green tissue‐preferential constitutive promoter.

show abstract

A maize α-zein promoter drives an endosperm-specific expression of transgene in rice

Cited by 10 publications

References 53 publications

Genetic transformation of tropical maize (Zea mays L.) inbred line with a phytase gene from Aspergillus niger

Genetic transformation of tropical maize (Zea mays L.) inbred line with a phytase gene from Aspergillus niger

Isolation of five rice nonendosperm tissue‐expressed promoters and evaluation of their activities in transgenic rice

Novel synthetic inducible promoters controlling gene expression during water‐deficit stress with green tissue specificity in transgenic poplar

Contact Info

Product

Resources

About