A COLQ Missense Mutation in Labrador Retrievers Having Congenital Myasthenic Syndrome

Abstract

Congenital myasthenic syndromes (CMSs) are heterogeneous neuromuscular disorders characterized by skeletal muscle weakness caused by disruption of signal transmission across the neuromuscular junction (NMJ). CMSs are rarely encountered in veterinary medicine, and causative mutations have only been identified in Old Danish Pointing Dogs and Brahman cattle to date. Herein, we characterize a novel CMS in 2 Labrador Retriever littermates with an early onset of marked generalized muscle weakness. Because the sire and dam share 2 recent common ancestors, CMS is likely the result of recessive alleles inherited identical by descent (IBD). Genome-wide SNP profiles generated from the Illumina HD array for 9 nuclear family members were used to determine genomic inheritance patterns in chromosomal regions encompassing 18 functional candidate genes. SNP haplotypes spanning 3 genes were consistent with autosomal recessive transmission, and microsatellite data showed that only the segment encompassing COLQ was inherited IBD. COLQ encodes the collagenous tail of acetylcholinesterase, the enzyme responsible for termination of signal transduction in the NMJ. Sequences from COLQ revealed a variant in exon 14 (c.1010T>C) that results in the substitution of a conserved amino acid (I337T) within the C-terminal domain. Both affected puppies were homozygous for this variant, and 16 relatives were heterozygous, while 288 unrelated Labrador Retrievers and 112 dogs of other breeds were wild-type. A recent study in which 2 human CMS patients were found to be homozygous for an identical COLQ mutation (c.1010T>C; I337T) provides further evidence that this mutation is pathogenic. This report describes the first COLQ mutation in canine CMS and demonstrates the utility of SNP profiles from nuclear family members for the identification of private mutations.

Congenital myasthenic syndrome in Golden Retrievers is associated with a novel COLQ mutation

“…Esterase histochemistry similarly localizes motor end‐plates with variants in both genes. Staining for AChRs with fluorescein labeled α‐bgt, however, was not detectable in dogs with the CHRNE mutation, and was decreased but detectable compared to control muscle in the puppies with the COLQ mutation. Consistent with this finding, the decremental responses of the CMAP to repetitive nerve stimulation were more marked in the CHRNE mutation (decrements of the CMAP of up to 66%) compared to mild decreases in the dogs with the COLQ mutation.…”

“…Clinical differences should be apparent between CMS caused by variants in the COLQ and CHRNE genes. Although fatigability is present with mutations in both genes, challenge with the short‐acting cholinergic agonist edrophonium chloride or treatment with the longer acting pyridostigmine bromide results in improved muscle strength in dogs with the CHRNE mutation but no response or worsening of muscle weakness after cholinergic agonists in dogs with the COLQ variant. In end‐plate AChR deficiency associated with mutations in CHRNE , the safety margin of neuromuscular transmission is compromised by a decreased response to acetylcholine because of low AChR content.…”

“…Polymerase chain reactions (PCRs) to amplify the 17 exons of genomic COLQ were performed using previously described primers and protocols . Primers to amplify the last 7 exons of the COLQ transcript were designed with the forward primer (5′ GGGCAGAAAGGTGAAATGGGT) spanning the exon 10 and 11 junction and the reverse primer located in exon 17 (5′ ATGTGAAGTAGCGGCAGGAC).…”

“…Although the first clinical report of congenital MG in dogs was published in 1974, only a few gene mutations causing CMS have been identified. These include a missense mutation in the gene encoding choline acetyltransferase in Danish Pointing dogs, a nonsynonymous mutation in the gene encoding the collagen‐like tail of the asymmetric acetylcholinesterase ( COLQ ) in Labrador Retrievers, and a deletion and nonsynonymous mutation in the gene encoding the epsilon subunit of the nicotinic acetylcholine receptor ( CHRNE) in Jack Russell Terriers and in Heideterriers, respectively. Congenital myasthenic syndromes also have been clinically described in Smooth Fox terriers and English Springer Spaniels, but mutations have not yet been described.…”

COLQ variant associated with Devon Rex and Sphynx feline hereditary myopathy

“…2002), whereas Labrador retrievers are the only companion animal species with a naturally occurring COLQ variant causing a CMS (OMIA 001928‐9615) (Rinz et al . 2014). …”