5-HT7 receptor mRNA expression in human trigeminal ganglia

Current and prospective pharmacological targets in relation to antimigraine action

“…Indeed, mRNA of 5-HT 7 receptors is present in trigeminal ganglia (Terrón et al 2001). Since dilatation of cranial blood vessels has been proposed to play an important role in the pathogenesis of a migraine attack , 5-HT 7 receptor antagonists could well be effective as prophylactic antimigraine agents (Terrón et al 2001).…”

“…Indeed, mRNA of 5-HT 7 receptors is present in trigeminal ganglia (Terrón et al 2001). Since dilatation of cranial blood vessels has been proposed to play an important role in the pathogenesis of a migraine attack , 5-HT 7 receptor antagonists could well be effective as prophylactic antimigraine agents (Terrón et al 2001). A number of 5-HT 7 receptor-selective antagonists, including SB-269970A, SB-258741, and SB-656104A, have been developed (Pouzet 2002;Thomas and Hagan 2004) but, obviously, clinical trials are needed to accept or reject their proposed mechanism of action.…”

GABA, but not opioids, mediates the anti-hyperalgesic effects of 5-HT7 receptor activation in rats suffering from neuropathic pain

“…Its mRNA is expressed in dorsal root and trigeminal ganglia (Pierce et al, 1996;Terron et al, 2001). In the dorsal horn of the spinal cord, 5-HT 7 R is present in laminae IeII and III on Av and C primary afferent fibers, on peptidergic interneurons and on glial cells (Doly et al, 2005;Neumaier et al, 2001).…”

Structure of the human 5-HT7 receptor gene and characterization of its promoter region

“…PCR products were analysed by electrophoresis using 6% polyacrylamide (Serva, Germany) gels. For the 5-HT 7 receptor, the published primer sequences, F1 (GGAACAGATCAAC-TACGGCAGAGT) and B1 (GGTGGTGGCTGCTTTCTGTT-CTCGCTTAAA) (Terron et al, 2001) were used generating a fragment of 780 bp. As control, we used GAPDH primers (forward primer: ACCACAGTCCATGCCATCAC; reverse primer: TCCACCACCCTGTTGCTGTA) expecting an amplification product of 452 bp.…”