A novel IncA plasmid carrying blaVIM-1 in a Kluyvera cryocrescens strain

Gaibani, Paolo; Ambretti, Simone; Scaltriti, Erika; Cordovana, Miriam; Berlingeri, Andrea; Pongolini, Stefano; Landini, Maria Paola; Re, Maria Carla

doi:10.1093/jac/dky304

Cited by 7 publications

(5 citation statements)

References 11 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…The RI-2 region, which carries the VIM-encoding integron In1461 and is bracketed by IS4321R and intI1, was present in opposite orientation in the two plasmids. The Tn7107-like transposon and Tn402-like transposon were interrupted by Tn6443 in RI-KC-BO-N1-VIM and were not found in pR210-2-VIM, but a composite transposon, Tn402, bracketed by 27-bp (ATCTCGACTATGCTCAATACTCGTGTG) inverted repeats was observed (15,16). The In1461 element, which carries the cassette array (intI1, bla VIM-1 , aacA4, aphA15, aacA4, aphA15, aadA1b, and catB2) and 5= and 3= conserved sequences (CSs) was found located within the Tn402 in the RI-R210-2-VIM fragment (Fig.…”

mentioning

confidence: 96%

“…BLAST analysis showed that pR210-2-VIM was 99% identical to plasmid pKC-BO-N1-VIM (GenBank accession number MG228427), which was recovered from a Kluyvera cryocrescens strain, and plasmid pIncAC-KP4898 (GenBank accession number KY882285), which was recovered from an ST104 K. pneumoniae strain, both at 99% coverage (Fig. S3) (14,15). The main structural difference between pR210-2-VIM and pKC-BO-N1-VIM lies in the resistance island (RI) (Fig.…”

mentioning

confidence: 99%

“…On the other hand, the RI of pKC-BO-N1-VIM (RI-KC-BO-N1-VIM) was 55,739 bp in size and found to comprise three elements (RI-1, RI-2, and RI-3) according to the distinct structural features of these RIs (Fig. 1B) (15). The RI-3 region in RI-KC-BO-N1-VIM carries multiple antimicrobial resistance determinants (bla SHV-12 , bla AAC-1 , qnrS1, strA, strB, and sul2), as well as the Tn6444 transposon, the genomic island GI SHV/AAC , and the element of the Tn7107-like transposon; it should also be noted that ΔISPa17 was completely absent in pR210-2-VIM (Fig.…”

mentioning

confidence: 99%

See 2 more Smart Citations

Evolution of Carbapenem-Resistant Serotype K1 Hypervirulent Klebsiella pneumoniae by Acquisition of bla _VIM-1 -Bearing Plasmid

Dong

Sun

Huang

et al. 2019

Antimicrob Agents Chemother

View full text Add to dashboard Cite

We report the identification of a carbapenem-resistant, hypervirulent Klebsiella pneumoniae (hvKp) strain which produced the carbapenemase VIM-1. Genomic analysis showed that the strain belonged to sequence type ST23 and serotype K1, a major hvKp clone, and harbored three resistance-encoding plasmids. Among them, a blaVIM-1-bearing plasmid was found to possess a mosaic structure presumably generated by multiple gene mobilization events. This finding indicates that hvKp actively acquires mobile resistance-encoding elements, facilitating simultaneous expression of hypervirulence and carbapenem-resistance.

show abstract

mentioning

confidence: 96%

mentioning

confidence: 99%

mentioning

confidence: 99%

See 1 more Smart Citation

Evolution of Carbapenem-Resistant Serotype K1 Hypervirulent Klebsiella pneumoniae by Acquisition of bla _VIM-1 -Bearing Plasmid

Dong

Sun

Huang

et al. 2019

Antimicrob Agents Chemother

View full text Add to dashboard Cite

show abstract

“…The bla VIM genes are mostly found in Pseudomonas and Enterobacteriaceae and occur frequently within class 1 integrons with distinct gene cassette arrays (GCAs). The bla VIM -carrying integrons are always presented in various mobile genetic elements (MGEs) such as plasmids, integrative and conjugative elements (ICEs), and integrative and mobilizable elements (IMEs), enhancing the mobility and dissemination of bla VIM genes [2].There are a wealth of sequenced bla VIM -carrying plasmids, which can be assigned to various incompatibility (Inc) groups such as IncA, IncC, IncN, IncP and IncL/M [3][4][5][6][7]. IMEs/ICEs are frequently located in bacterial chromosomes: ICEs encode self-conjugation modules and thus are able to transfer between cells [8], whereas IMEs needs a helper conjugative element to achieve intercellular mobility [9].…”

Section: Introductionmentioning

confidence: 99%

VIM-encoding IncpSTY plasmids and chromosome-borne integrative and mobilizable elements (IMEs) and integrative and conjugative elements (ICEs) in Pseudomonas

Chen

Wang

Yin

et al. 2022

Ann Clin Microbiol Antimicrob

View full text Add to dashboard Cite

Background The carbapenem-resistance genes blaVIM are widely disseminated in Pseudomonas, and frequently harbored within class 1 integrons that reside within various mobile genetic elements (MGEs). However, there are few reports on detailed genetic dissection of blaVIM-carrying MGEs in Pseudomonas. Methods This study presented the complete sequences of five blaVIM-2/-4-carrying MGEs, including two plasmids, two chromosomal integrative and mobilizable elements (IMEs), and one chromosomal integrative and conjugative element (ICE) from five different Pseudomonas isolates. Results The two plasmids were assigned to a novel incompatibility (Inc) group IncpSTY, which included only seven available plasmids with determined complete sequences and could be further divided into three subgroups IncpSTY-1/2/3. A detailed sequence comparison was then applied to a collection of 15 MGEs belonging to four different groups: three representative IncpSTY plasmids, two Tn6916-related IMEs, two Tn6918-related IMEs, and eight Tn6417-related ICEs and ten of these 15 MGEs were first time identified. At least 22 genes involving resistance to seven different categories of antibiotics and heavy metals were identified within these 15 MGEs, and most of these resistance genes were located within the accessory modules integrated as exogenous DNA regions into these MGEs. Especially, eleven of these 15 MGEs carried the blaVIM genes, which were located within 11 different concise class 1 integrons. Conclusion These blaVIM-carrying integrons were further integrated into the above plasmids, IMEs/ICEs with intercellular mobility. These MGEs could transfer between Pseudomonas isolates, which resulted in the accumulation and spread of blaVIM among Pseudomonas and thus was helpful for the bacteria to survival from the stress of antibiotics. Data presented here provided a deeper insight into the genetic diversification and evolution of VIM-encoding MGEs in Pseudomonas.

show abstract

“…The bla VIM genes are mainly reported in IncN [6,7], IncY [8], IncR [9], and IncA type plasmids [10]. The IncA group, once assigned to the IncA/C family, was later allocated to a separate incompatibility group, not yet well characterized and recently recognized as an alternative reservoir of carbapenemase genes in the Enterobacterales family [11,12]. Here we characterize a VIM-producing IncA plasmid isolated from a clinical ST69 E. coli strain from an Italian Long-Term Care Facility (LTCF) inpatient.…”

Section: Introductionmentioning

confidence: 99%

Genomic Insight of VIM-harboring IncA Plasmid from a Clinical ST69 Escherichia coli Strain in Italy

et al. 2020

View full text Add to dashboard Cite

Background: VIM (Verona Integron-encoded Metallo-beta-lactamase) is a member of the Metallo-Beta-Lactamases (MBLs), and is able to hydrolyze all beta-lactams antibiotics, except for monobactams, and including carbapenems. Here we characterize a VIM-producing IncA plasmid isolated from a clinical ST69 Escherichia coli strain from an Italian Long-Term Care Facility (LTCF) inpatient. Methods: An antimicrobial susceptibility test and conjugation assay were carried out, and the transferability of the blaVIM-type gene was confirmed in the transconjugant. Whole-genome sequencing (WGS) of the strain 550 was performed using the Sequel I platform. Genome assembly was performed using “Microbial Assembly”. Genomic analysis was conducted by uploading the contigs to ResFinder and PlasmidFinder databases. Results: Assembly resulted in three complete circular contigs: the chromosome (4,962,700 bp), an IncA plasmid (p550_IncA_VIM_1; 162,608 bp), harboring genes coding for aminoglycoside resistance (aac(6′)-Ib4, ant(3″)-Ia, aph(3″)-Ib, aph(3′)-XV, aph(6)-Id), beta-lactam resistance (blaSHV-12, blaVIM-1), macrolides resistance (mph(A)), phenicol resistance (catB2), quinolones resistance (qnrS1), sulphonamide resistance (sul1, sul2), and trimethoprim resistance (dfrA14), and an IncK/Z plasmid (p550_IncB_O_K_Z; 100,306 bp), free of antibiotic resistance genes. Conclusions: The increase in reports of IncA plasmids bearing different antimicrobial resistance genes highlights the overall important role of IncA plasmids in disseminating carbapenemase genes, with a preference for the blaVIM-1 gene in Italy.

show abstract

A novel IncA plasmid carrying blaVIM-1 in a Kluyvera cryocrescens strain

Cited by 7 publications

References 11 publications

Evolution of Carbapenem-Resistant Serotype K1 Hypervirulent Klebsiella pneumoniae by Acquisition of bla _VIM-1 -Bearing Plasmid

Evolution of Carbapenem-Resistant Serotype K1 Hypervirulent Klebsiella pneumoniae by Acquisition of bla _VIM-1 -Bearing Plasmid

VIM-encoding IncpSTY plasmids and chromosome-borne integrative and mobilizable elements (IMEs) and integrative and conjugative elements (ICEs) in Pseudomonas

Genomic Insight of VIM-harboring IncA Plasmid from a Clinical ST69 Escherichia coli Strain in Italy

Contact Info

Product

Resources

About

A novel IncA plasmid carrying blaVIM-1 in a Kluyvera cryocrescens strain

Cited by 7 publications

References 11 publications

Evolution of Carbapenem-Resistant Serotype K1 Hypervirulent Klebsiella pneumoniae by Acquisition of bla VIM-1 -Bearing Plasmid

Evolution of Carbapenem-Resistant Serotype K1 Hypervirulent Klebsiella pneumoniae by Acquisition of bla VIM-1 -Bearing Plasmid

VIM-encoding IncpSTY plasmids and chromosome-borne integrative and mobilizable elements (IMEs) and integrative and conjugative elements (ICEs) in Pseudomonas

Genomic Insight of VIM-harboring IncA Plasmid from a Clinical ST69 Escherichia coli Strain in Italy

Contact Info

Product

Resources

About

Evolution of Carbapenem-Resistant Serotype K1 Hypervirulent Klebsiella pneumoniae by Acquisition of bla _VIM-1 -Bearing Plasmid

Evolution of Carbapenem-Resistant Serotype K1 Hypervirulent Klebsiella pneumoniae by Acquisition of bla _VIM-1 -Bearing Plasmid