Analysis of Streptomyces coelicolor M145 genes SCO4164 and SCO5854 encoding putative rhodaneses

Abstract

Streptomyces coelicolor genome carries two apparently paralogous genes, SCO4164 and SCO5854, that encode putative thiosulfate sulfurtransferases (rhodaneses). These genes (and their presumed translation products) are highly conserved and widely distributed across actinobacterial genomes. The SCO4164 knockout strain was unable to grow on minimal media with either sulfate or sulfite as the sole sulfur source. The SCO5854 mutant had no growth defects in the presence of various sulfur sources; however, it produced significantly less amounts of actinorhodin. Furthermore, we discuss possible links between basic interconversions of inorganic sulfur species and secondary metabolism in S. coelicolor.

Genetic analysis of sulfate assimilation gene cluster of Streptomyces coelicolor A3(2)

“…S. coelicolor M145, a prototrophic variant of A3(2) [4], was used throughout the work. Cosmid 3F08 carrying sco6093-sco6102 stretch was kindly provided by Prof. M. Bibb (John Innes Centre, UK).…”

“…Genome browser at StrepDB database https://strepdb.streptomyces.org.uk was used to locate and retrieve the sequences of sco genes. Integrative vector pIJ6902 [4] was used to construct complementation plasmids. The sco genes of interest were individually replaced with apramycin resistance cassette oriT-aac(3)IV from plasmid pIJ774 using recombineering approach [7].…”

“…The generated cosmid 3F08∆6101 was PCR-verified with primers flanking the deletion (SK72-6101-kfor (AAAGAATTCCACGTCCATCACGGCCTC) and SK72-6101-k-rev (AAAGGATCCTCTG-CAAGCTCGCCATCGTC)), alone or in combination with the primers to internal aac(3)IV sequences. The cosmid was transferred conjugally into M145 from E. coli ET12567 (pUZ8002) [4]; transconjugants were selected for apramycin resistance and kanamycin sensitivity (double crossover, loss of vector sequences). Strain verification was done as described above for the cosmid.…”

“…In this way we generated eight S. coelicolor mutants: ∆sco6094, ∆sco6095, ∆sco6096, ∆sco6097, ∆sco6098, ∆sco6099, ∆sco6100 and ∆sco6101. For growth test we used minimal medium [4] supplemented with various sulfur sources (final concentration of 2 mM), as in [2]. Standard bioinformatics tools such as BLASTP, HHpred, TMHMM, STRING were used to mine for M145 sulfur metabolism genes and predict their function.…”

“…In this regard, we showed previously that knockouts of two paralogous genes for rhodanese-like proteins in model species S. coelicolor A3(2) led to distinct phenotypes. The sco4164 deletion blocked growth on sulfate and sulfite as a sole sulfur source, while sco5854 knockout only suppressed production of antibiotic actinorhodin [4]. Our knowledge of sulfur metabolism in antibiotic-producing streptomycetes is very fragmentary and outdated [5] given the current advances in genomics and understanding of reduced S species in streptomycete physiology [6].…”