NEUROD2 RegulatesStim1Expression and Store-Operated Calcium Entry in Cortical Neurons

Abstract

Calcium signaling controls many key processes in neurons, including gene expression, axon guidance, and synaptic plasticity. In contrast to calcium influx through voltage- or neurotransmitter-gated channels, regulatory pathways that control store-operated calcium entry (SOCE) in neurons are poorly understood. Here, we report a transcriptional control of Stim1 (stromal interaction molecule 1) gene, which is a major sensor of endoplasmic reticulum (ER) calcium levels and a regulator of SOCE. By using a genome-wide chromatin immunoprecipitation and sequencing approach in mice, we find that NEUROD2, a neurogenic transcription factor, binds to an intronic element within the Stim1 gene. We show that NEUROD2 limits Stim1 expression in cortical neurons and consequently fine-tunes the SOCE response upon depletion of ER calcium. Our findings reveal a novel mechanism that regulates neuronal calcium homeostasis during cortical development.

Terminal neuron localization to the upper cortical plate is controlled by the transcription factor NEUROD2

“…Here we report a comparative analysis of the genetic targets of the TF NEUROD2 and reveal a new role for NEUROD2 in the terminal stage of cortical radial migration. We had previously reported NEUROD2 targets identified by ChIP-Seq experiments both in embryonic and postnatal cerebral cortices 26,27 and here we have complemented these earlier studies by a comparative analyses of these two developmental timepoints. Furthermore, in order to focus upon targets whose expression is regulated by NEUROD2, we silenced its expression in primary cortical neurons and carried out an RNA-Seq analysis.…”

“…To evaluate whether NEUROD2 interactions with specific genomic sites are temporally regulated, we compared NEUROD2 binding profiles between embryonic day 14.5 (E14.5) and postnatal day 0 (P0). We retrieved binding scores from our previously published NEUROD2 ChIP-Seq datasets that represent the amount of relative TF binding to target sequences and carried out a comparative analysis using the E14.5 and P0 results 26,27 . Based upon this comparison, we identified a large number of binding sites that were exclusively targeted at E14.5, and fewer sites that were targeted at both developmental stages or were specific to P0 (Supplemental Material 1) ( Fig.…”

“…To our surprise, we observed a much weaker (approximately 15% of the control) but significant (p=0.02) increase in REELIN at the protein level. To demonstrate the specificity of this effect, we rescued the increase in REELIN levels by coexpressing a previously characterized 26 shRNA-resistant Neurod2 cDNA ( Fig. 4E and F).…”

“…Formaldehydecrosslinking, followed by chromatin DNA isolation from input and immunoprecipitated samples, was performed as described previously 27 . Cq values from immunoprecipitated DNA were normalized to those from input DNA as described 26 . Primer sequences used for qPCR experiments were as follows: Reln-peak1-F (AATGGAAACTGGCTCGCATG); Reln-peak1-R (ATCCTGAGCAATGAGTGGCT); Reln-peak2-F (TGTTTCTGTGGTCTGCTTGC); Reln-peak2-R (AAAACAATCACAGGCGAGCC); Reln-peak3-F (GCCGGACTACCCTGATGATT); Reln-peak3-R (TGGAGGAAATGGATGGCTCT); Reln-peak4-F (GGCCTCCTGTCTTACTAGCC);…”

“…We previously characterized the genetic targets of NEUROD2 in the cerebral cortex at two developmental timepoints: embryonic day 14.5 (E14.5), representing the peak of neurogenesis and migration in the mouse cortex; and postnatal day 0 (P0), representing the onset of neuronal differentiation, dendritic growth and synaptogenesis 26,27 . Here, we carry out a comparative analysis of these two datasets and overlay it with transcriptomics analysis of primary neurons where Neurod2 expression is knocked down.…”