Trehalose-6-Phosphate-Mediated Toxicity Determines Essentiality of OtsB2 in Mycobacterium tuberculosis In Vitro and in Mice

Abstract

Trehalose biosynthesis is considered an attractive target for the development of antimicrobials against fungal, helminthic and bacterial pathogens including Mycobacterium tuberculosis. The most common biosynthetic route involves trehalose-6-phosphate (T6P) synthase OtsA and T6P phosphatase OtsB that generate trehalose from ADP/UDP-glucose and glucose-6-phosphate. In order to assess the drug target potential of T6P phosphatase, we generated a conditional mutant of M. tuberculosis allowing the regulated gene silencing of the T6P phosphatase gene otsB2. We found that otsB2 is essential for growth of M. tuberculosis in vitro as well as for the acute infection phase in mice following aerosol infection. By contrast, otsB2 is not essential for the chronic infection phase in mice, highlighting the substantial remodelling of trehalose metabolism during infection by M. tuberculosis. Blocking OtsB2 resulted in the accumulation of its substrate T6P, which appears to be toxic, leading to the self-poisoning of cells. Accordingly, blocking T6P production in a ΔotsA mutant abrogated otsB2 essentiality. T6P accumulation elicited a global upregulation of more than 800 genes, which might result from an increase in RNA stability implied by the enhanced neutralization of toxins exhibiting ribonuclease activity. Surprisingly, overlap with the stress response caused by the accumulation of another toxic sugar phosphate molecule, maltose-1-phosphate, was minimal. A genome-wide screen for synthetic lethal interactions with otsA identified numerous genes, revealing additional potential drug targets synergistic with OtsB2 suitable for combination therapies that would minimize the emergence of resistance to OtsB2 inhibitors.

Free Trehalose Accumulation in Dormant Mycobacterium smegmatis Cells and Its Breakdown in Early Resuscitation Phase

“…In the mouse model of active tuberculosis the OtsAB2 pathway, which generates trehalose from glucose and glucose-6-phosphate, is the dominant pathway required for M. tuberculosis growth and virulence (Murphy et al, 2005). However, recent studies revealed that essentiality of OtsB2 gene in vivo for the acute infection is due to self-poisoning of knock-outed cells by accumulation of trehalose-6-phosphate (Korte et al, 2016). Inactivation of the second (TreYZ) pathway, which generates trehalose from α-1,4-linked glucose polymers, had no effect on the growth of M. tuberculosis in mice (Murphy et al, 2005).…”

The mycolic acid reductase Rv2509 has distinct structural motifs and is essential for growth in slow‐growing mycobacteria

“…We then utilised a promoter replacement strategy to demonstrate the essentiality of Rv2509 in slow‐growing mycobacterial vaccine strain Mycobacterium bovis BCG. The P myc1 promoter from M. smegmatis engineered to contain four tetO operator sites (Korte et al, ) was inserted immediately upstream of the start codon of BCG2529, the Rv2509 homologue in M. bovis BCG‐Pasteur, using Specialised Transduction generating the strain BCG::P Tet ‐ BCG2529 . Controlled gene expression of the BCG2529 gene was achieved using a plasmid‐borne synthetic gene ( rev‐tetR ) derived from Tn10 tetR encoding a mutated TetR protein with reversed binding affinity to tetO sites upon the binding of tetracycline.…”

“…For establishing the regulated expression of the BCG2529 gene, a synthetic gene cassette ( hyg ‐P myc1 ‐4X tetO ) comprising a hygromycin‐resistance gene and the P myc1 promoter from M. smegmatis engineered to contain four tetO operator sites (Korte et al, ) was inserted immediately upstream of the BCG2529 start codon in M. bovis BCG‐Pasteur. Targeted gene knock‐in was achieved by specialised transduction employing temperature‐sensitive mycobacteriophages essentially as described previously (Korte et al, ). Briefly, for the generation of an allelic exchange construct for site‐specific insertion of the hyg ‐P myc1 ‐4X tetO cassette in M. bovis BCG‐Pasteur, upstream‐ and downstream DNA regions flanking the BCG2529 start codon were amplified by PCR employing the oligonucleotide pairs Mb2537 _LL 5′‐TTTTTCCATAAATTGGAACCGCTACCTGACATGAAACCC‐3′ and Mb2537 _LR 5′‐TTTTTCCATTTCTTGGGCCGATGTTCTGCGAAGCCCCGG‐3′ as well as Mb2537 _RL 5′‐TTTTTCCATAGATTGGATGCCGATACCCGCGCCCAGCCC‐3′ and Mb2537 _RR 5′‐TTTTTCCATCTTTTGGCGGTGTGGGAGGAGATACTCAAG‐3′ respectively.…”

“…Since it could not be excluded that the Mb2536c promoter region might overlap with the BCG2529 coding region, the upstream flanking region contained a duplication of 66 bp of the 5′‐end of BCG2529 to conserve 150 bp in front of BCG2529 that likely comprised its promoter. Subsequently, the upstream and downstream flanks were digested with Van 91I (restriction sites underlined) and ligated with Van 91I‐digested pcRv1327c‐4XtetO vector arms (Korte et al, ). The resulting knock‐in plasmid was then linearised with Pac I and cloned and packaged into the temperature‐sensitive phage phAE159 (Jain et al, ), yielding a knock‐in phage which was propagated in M. smegmatis at 30°C.…”

Trehalose 6‐phosphate phosphatases ofPseudomonas aeruginosa

“…In addition to the treYZ pathway, another 4 additional pathways of trehalose biosynthesis have been observed in prokaryotes, plants, fungi, and nonvertebrate animals. Among those other pathways, the so-called osmotically regulated trehalose synthesis (ots)AB pathway has attracted particular attention as a target of interest for therapeutic intervention in infectious diseases [reviewed in Cross et al (12)] because accumulation of the metabolite trehalose 6-phosphate (T6P) results in a lethal phenotype in Caenorhabditis elegans and Mycobacterium tuberculosis (13,14).…”