Ultra-deep sequencing of VHSV isolates contributes to understanding the role of viral quasispecies

Abstract

The high mutation rate of RNA viruses enables the generation of a genetically diverse viral population, termed a quasispecies, within a single infected host. This high in-host genetic diversity enables an RNA virus to adapt to a diverse array of selective pressures such as host immune response and switching between host species. The negative-sense, single-stranded RNA virus, viral haemorrhagic septicaemia virus (VHSV), was originally considered an epidemic virus of cultured rainbow trout in Europe, but was later proved to be endemic among a range of marine fish species in the Northern hemisphere. To better understand the nature of a virus quasispecies related to the evolutionary potential of VHSV, a deep-sequencing protocol specific to VHSV was established and applied to 4 VHSV isolates, 2 originating from rainbow trout and 2 from Atlantic herring. Each isolate was subjected to Illumina paired end shotgun sequencing after PCR amplification and the 11.1 kb genome was successfully sequenced with an average coverage of 0.5–1.9 × 106 sequenced copies. Differences in single nucleotide polymorphism (SNP) frequency were detected both within and between isolates, possibly related to their stage of adaptation to host species and host immune reactions. The N, M, P and Nv genes appeared nearly fixed, while genetic variation in the G and L genes demonstrated presence of diverse genetic populations particularly in two isolates. The results demonstrate that deep sequencing and analysis methodologies can be useful for future in vivo host adaption studies of VHSV.

Investigation of round goby viral haemorrhagic septicaemia outbreak in New York

“…Reverse transcription was completed following the protocol described by Schönherz et al () and the instructions in the SuperScript III First‐Strand Synthesis System for RT‐PCR (Invitrogen). The 20 μl of VHSV genome cDNA was synthesized from the RNA extracted with the MagMax‐96 viral RNA isolation kit as described above and stored at −80°C.…”

“…However, heavily infected fish can carry the virus without showing any clinical signs (Cornwell, Eckerlin, et al, ; Groocock et al, ). Viral haemorrhagic septicaemia virus, like most RNA viruses, shows high evolutionary potential because of its high replication rate and mutation rate of 10 −3 –10 −5 mutations per nucleotide, per replication (Schönherz, Lorenzen, Guldbrandtsen, Buitenhuis, & Einer‐Jensen, ) . This genetic diversity allows the virus to rapidly adapt to new environments and hosts, while requiring little change to alter its virulence.…”

Genomic and immunogenic changes over the history of the Viral Hemorrhagic Septicemia (VHS-IVb) fish virus (=Piscine novirhabdovirus) in the Laurentian Great Lakes

“…cDNA was synthesized from total RNA extracted from tissue samples using SuperScript 168 IV (Invitrogen), following manufacturer's instructions. Genomic cDNA was amplified in four 169 segments using primers from Schönherz [58], substituting VHSV_Frag1I_nt18_+s with a more 170 specific primer (5'GAGAGCTGCAGCACTTCACCG C3'), and 1µl cDNA in 25µL reactions 171 with One Taq DNA polymerase (New England Biolabs). Amplicons were examined under UV 7 light on 1% agarose gels stained with ethidium bromide.…”

“…Additional PCRs amplified the front 700 nucleotides (NTs) and end 400 NTs of the 175 genome, with 45 s extension time. The front segment utilized VHSV_Frag1I_nt18_+s 176 (5'GAGTTATGTTACARGGGACAGG3') [58] and anti-sense 177 5'TGACCGAGATGGCAGATC3', and end primers were designed based on the VHSV-IVb 178 genome (GenBank: GQ385941) (End sense: 5'CCCAGATGCTATCACCGAGAA3', End anti-179 sense 5'ACAAAGAATCCGAGGCAGGAG3'). Cleaned products were Sanger sequenced at 180…”

Contribution of Next-Generation Sequencing to Aquatic and Fish Virology

“…However, it has not been established whether these virulent variants preexisted in wild fish or if they arose and were selected in farmed trout. In a recent study, ultra-deep sequencing on 4 “isolates” of VHSV were passaged in vitro [127] showed that the number of variants within a specimen is very variable, from 100 to only 3. No fewer than 89 polymorphic sites were observed for single isolate specimen.…”