Limitation of high-resolution melting curve analysis for genotyping simple sequence repeats in sheep

Abstract

ABSTRACT. Variation in microsatellite or simple sequence repeat (SSR) loci has, until recently, relied heavily on the use of gel-based methods that can be both time consuming and difficult to genotype. Non gel-based systems are therefore important to increase simplicity and improve turn-around time without compromising assay sensitivity and accuracy. In this report, we assessed the latest of the non-gelbased methods, high-resolution melting (HRM) curve analysis. HRM is a technique that monitors exactly the decreasing fluorescence of intercalating dye in the process of dissociation of double-stranded DNA. The measurement immediately follows polymerase chain reaction in a one-step, closed-tube method. Four SSR loci of different complexity in sheep, namely MAF209, MCM140, CB226, and SRCRSP5, were assessed using the LightScanners System with LC Greens PLUS DNA binding dye. In order to improve the accuracy of genotyping, we applied internal oligo nucleotide calibrators while performing HRM. DNA polymorphisms were previously identified using capillary electrophoresis analysis (CE). The result showed that CE detected more genotypes than HRM in the same loci regardless of the level of polymorphism at the SSR loci. We demonstrate current limitations of the HRM method for the analysis of SSR loci.

High-Resolution Melting (HRM) Analysis Reveals Genotypic Differentiation of Venturia inaequalis Populations in Greece

“…limitations were also observed by Yang et al (2014) in SSR-HRM genotyping in sheep. In the present assay, the melting curves were genotype-specific and one melting peak per isolate was generated in each SSR locus, consistent with the haploid nature of V. inaequalis (Koopman et al, 2017).…”

Evaluating Short Sequence Repeats (SSRs) Markers in Sordaria fimicola by High Resolution Melt Analysis

“…This study first time successfully utilized this technique for SSRs genotyping for S. fimicola. Yang et al (2014) also employed the same technique for genotyping of short sequence repeats in sheep and genotype 4 polymorphic loci in it. HRM has turned out to be a productive and pragmatic approach to recognize variation in nucleotide CATGTTGTTGCTGTTGTAGTTGCACATTTGTTGTTGTTGTTGTTGTTGTCAAGAGAGGTT 60 ****************************************************************************** Ref GCAGTCCAGTGTTGTTGTTGTTGTTGTTGTTGTTTTTGTTGTTGTTGTTGTTGTTGTCAA 120 S1…”

HRM Efficiency and Limitations for High-Throughput SSR Genotyping: A Case Study Using Grapevine Flavor-Linked Markers

“…Genetic diversity studies based on variation of simple sequence repeats (SSRs), have been greatly relied on easy to use gel-based techniques which, however, can be both time-consuming as well as inefficient for accurate genotyping [1]. Other techniques, like capillary electrophoresis (CE) requires post-PCR handling and is expensive.…”