Rock outcrop orchids reveal the genetic connectivity and diversity of inselbergs of northeastern Brazil

Abstract

BackgroundBecause of their fragmented nature, inselberg species are interesting biological models for studying the genetic consequences of disjoint populations. Inselbergs are commonly compared with oceanic islands, as most of them display a marked ecological isolation from the surrounding area. The isolation of these rock outcrops is reflected in the high number of recorded endemic species and the strong floristic differences between individual inselbergs and adjacent habitats. We examined the genetic connectivity of orchids Epidendrum cinnabarinum and E. secundum adapted to Neotropical inselbergs of northeastern Brazil. Our goals were to identify major genetic divergences or disjunctions across the range of the species and to investigate potential demographic and evolutionary mechanisms leading to lineage divergence in Neotropical mountain ecosystems.ResultsBased on plastid markers, high genetic differentiation was found for E. cinnabarinum (FST = 0.644) and E. secundum (FST = 0.636). Haplotypes were not geographically structured in either taxon, suggesting that restricted gene flow and genetic drift may be significant factors influencing the diversification of these inselberg populations. Moreover, strong differentiation was found between populations over short spatial scales, indicating substantial periods of isolation among populations. For E. secundum, nuclear markers indicated higher gene flow by pollen than by seeds.ConclusionsThe comparative approach adopted in this study contributed to the elucidation of patterns in both species. Our results confirm the ancient and highly isolated nature of inselberg populations. Both species showed similar patterns of genetic diversity and structure, highlighting the importance of seed-restricted gene flow and genetic drift as drivers of plant diversification in terrestrial islands such as inselbergs.

Filogeografia de <i>Cattleya loddigesii</i> Lindl. e <i>Cattleya harrisoniana</i> (ex Lindl.) Bateman (Orchidaceae)

“…(2008) Estudos filogeográficos em espécies neotropicais têm sido importantes para testar zonas de refúgio na fauna e flora brasileira, e além disso, é possível inferir em outros padrões evolutivos que podem estar associados com a distribuição espacial das espécies (NOVAES et al, 2010;COOK et al, 2012;BRANDÃO, 2012;LIMA, 2012;ALVES, 2013;SCOTTI-SAINTAGNE et al, 2013;CORONADO et al, 2014;RUIZ-GARCÍA et al, 2015;MATOS et al, 2016). Entre as regiões mais estudadas se encontra a Mata Atlântica Brasileira, que possui grande parte dessa biodiversidade (CARNAVAL et al, 2009, COLOMBI et al, 2010THOMÉ et al, 2010;PINHEIRO et al, 2011;RIBEIRO et al, 2011;BATALHA-FILHO et al, 2012;AMARO et al, 2012;PINHEIRO et al, 2013;PINHEIRO et al, 2014;CARDOSO et al, 2015;RODRIGUES et al, 2015;RODRIGUES, 2015). Nesse contexto, estudos envolvendo biogeografia e filogeografia de diferentes seres vivos apontam a uma cadeia de eventos evolutivos que podem ter ocorrido no passado e que são responsáveis pela distribuição atual das espécies nos dias de hoje (TURCHETTO-ZOLET, 2013).…”

“…Apesar do aumento no interesse e incertezas resolvidas em estudos voltados às áreas neotropicais e em Orchidaceae em geral (ANTONELLI et al, 2010;SANTOS, 2011;TURCHETTO-ZOLLET et al, 2013;PINHEIRO et al, 2014;VAN DEN BERG, 2014;RODRIGUES, 2015;SALAZAR et al, 2016, entre outros), ainda há muito a se explorar nessas regiões, levando em conta a gama de diversidade que possuem. Além disso, nos últimos anos, as ferramentas utilizadas em estudos filogeográficos vêm ganhando forças e conseguindo alcançar maior número de dados e, para lidar com isso, conta com modelos estatísticos e softwares cada vez mais sofisticados para aproveitar o máximo de informações extraídas dos dados.…”

“…Contudo, diversos estudos ainda se concentram em dados moleculares citoplasmáticos e, na maioria das vezes, combinados com DNA nuclear (PALMA-SILVA, 2009;NEUBIG et al, 2009;NOVAES et al, 2010;SANTOS, 2011;NOVAES et al, 2013;PINHEIRO et al, 2013;LONGO et al, 2014;PINHEIRO et al, 2014;RODRIGUES et al, 2015).…”

“…A escolha desses marcadores foi baseada em trabalhos anteriores em que se mostraram propícios em estudos evolutivos no nível de populações e espécies em Orchidaceae (PINHEIRO et al, , 2013(PINHEIRO et al, , 2014SANTOS, 2011;RODRIGUES et al, 2015).…”

“…Ao comparar a estrutura genética das populações desse estudo com outros estudos similares de orquídeas é possível notar que o valor de ΦST para ITS foi considerado alto em relação às outras espécies para regiões nucleares e mais baixos para cpDNA (PINHEIRO et al, 2014;RODRIGUES, 2015 GCTGTTATTGGCATCAAACCAATAGCG ycf1 intF* GATCTGGACCAATGCACATATT ycf1 intR* TTTGATTGGGATGATCCAAGG *marcadores utilizados apenas na reação de sequenciamento.…”