Complete Genome Sequence of Channel Catfish Gastrointestinal Septicemia Isolate Edwardsiella tarda C07-087

Tekedar, Hasan C.; Karsi, Attila; Williams, Michele L.; Vamenta, Stefanie; Banes, Michelle M.; Duke, Mary V.; Scheffler, Brian E.; Lawrence, Mark L.

doi:10.1128/genomea.00959-13

Cited by 22 publications

(12 citation statements)

References 12 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…The isolate was deemed most closely related to E. piscicida based on initial genetic sequence analysis of the bacterial RNA polymerase β-subunit gene (rpoB) and the 16S ribosomal RNA gene (16S rRNA), and confirmed by sequence analysis of the DNA gyrase subunit B gene (gyrB). Across the analyzed rpoB segment, isolate CFDDL-1 most closely matched E. piscicida isolate C07-087 (GenBank CP004141) from channel catfish in Mississippi 25 and E. tarda isolate EIB202 (GenBank CP001135) from turbot (Scophthalmus maximus) in China, 28 with each sharing 352/355 bp (99.2% identity). Similarly, the 16S rRNA segment shared 100% identity (673/673 bp) with E. piscicida Repetitive sequence-mediated PCR BOX CTACGGCAAGGCGACGCTGACG 26,27 ERIC I ATGTAAGCTCCTGGGGATTCAC 26,27 ERIC II AAGTAAGTGACTGGGGTGAGCG 26,27 * F = forward; R = reverse; P = probe.…”

mentioning

confidence: 85%

Histologic and molecular characterization of Edwardsiella piscicida infection in largemouth bass (Micropterus salmoides)

et al. 2016

View full text Add to dashboard Cite

The genus Edwardsiella is composed of a diverse group of facultative anaerobic, gram-negative bacteria that can produce disease in a wide variety of hosts, including birds, reptiles, mammals, and fish. Our report describes the isolation and identification of Edwardsiella piscicida associated with chronic mortality events in 2 separate captive largemouth bass ( Micropterus salmoides) populations in New York and Florida. Wet-mount biopsies of skin mucus, gill, kidney, and spleen from several affected largemouth bass contained significant numbers of motile bacteria. Histologic examination revealed multifocal areas of necrosis scattered throughout the heart, liver, anterior kidney, posterior kidney, and spleen. Many of the necrotic foci were encapsulated or replaced by discrete granulomas and associated with colonies of gram-negative bacteria. Initial phenotypic and matrix-assisted laser desorption ionization–time of flight mass spectrometric analysis against existing spectral databases of recovered isolates identified these bacteria as Edwardsiella tarda. Subsequent molecular analysis using repetitive sequence mediated and species-specific PCR, as well as 16S rRNA, rpoB, and gyrB sequences, classified these isolates as E. piscicida. As a newly designated taxon, E. piscicida should be considered as a differential for multiorgan necrosis and granulomas in largemouth bass.

show abstract

mentioning

confidence: 85%

Histologic and molecular characterization of Edwardsiella piscicida infection in largemouth bass (Micropterus salmoides)

et al. 2016

View full text Add to dashboard Cite

show abstract

“…show 99.35% to 99.81% similarities to each other [7]. However, they are differing in chromosomal gene sequence, guanine and cytocine (G+C) content of the chromosome and extrachromosomal element [18][19][20][21][22]. Unlike E. ictaluri the other Edwardsiella spp.…”

Section: Phenotypic and Genotypic Characteristics Of The Bacteriummentioning

confidence: 99%

“…Unlike E. ictaluri the other Edwardsiella spp. chromosome have longer base pair (bp), that is, E. ictaruri has 43,378 bp [20], E. tarda (3,857,0403 bp) [19], E. hoshinae (3,811,650 bp) [22], E. piscicida (3,934,167 bp) [21]. All Edwardsiella spp.…”

Section: Phenotypic and Genotypic Characteristics Of The Bacteriummentioning

confidence: 99%

“…genome consists of one circular chromosome with respect to their G+C content. The G+C content of E. tarda, E. ictaruri, E. hoshinae, E. piscicida and E. anguillarum were identified as 59.6% [19], 52.6% [20], 56.9% [22], 59.1% [21] and 58.72% [8], respectively. As Reichley et al [21,22] reported that E. hoshinae isolated from Lizard and E. piscicida isolated from diseased Grouper have no extrachromosomal plasmid in there chromosome.…”

Section: Phenotypic and Genotypic Characteristics Of The Bacteriummentioning

confidence: 99%

See 1 more Smart Citation

Edwardsiella Species Infection in Fish Population and Its Status in Ethiopia

Kerie¹,

Nuru²,

Abayneh³

2019

Fish Aquac J

View full text Add to dashboard Cite

The genus Edwardsiella (E.) is a Gram-negative, glucose fermentative, catalase positive, and capable of producing H 2 S and indole (except E. ictaluri). It comprises the three previously isolated E. tarda, E. hoshinae, E. ictaluri and the two recently isolated E. piscicida, E. anguillarum species. Except E. hoshinae, other Edwardsiella spp. are pathogenic to fish, and only E. tarda is known to cause human infection. Pathogenic Edwardsiella spp. uses the virulence factors that include flagellin, adhesin, hemolysin, type III and type VI secretion systems to gain entry into and survive within the host. The status and distribution of edwardsiellosis in fish and its public health significance in Ethiopia is poorly understood, and thus needs further studies as aquaculture is growing in the country. Since differentiation of Edwardsiella spp. based only their phenotypic characteristics is less discriminatory than their genotypic characteristics, thus phenotypic studies should always be followed by genetic analysis of the bacterium. Therefore, the objective of this seminar paper is to review Edwardsiella infections in fish, its zoonotic importance and status in Ethiopia.

show abstract

“…In the catfish-farming region of the southeastern United States, E. tarda is associated with emphysematous putrefactive disease of catfish, which begins as small, cutaneous lesions that can progress to deep, malodorous, putrefactive abscesses within the musculature ( 6 , 7 ). While complete genome sequences for E. tarda have been published ( 8 – 10 ), these were later determined to be for E. piscicida , a newly adopted taxon in the Edwardsiella genus ( 11 – 13 ). The identity of E. tarda isolate FL95-01 was confirmed in previous research using repetitive sequence mediated PCR, gyrB sequence, and species-specific PCR ( 13 , 14 ).…”

Section: Genome Announcementmentioning

confidence: 99%

Complete Genome Sequence of Edwardsiella tarda Isolate FL95-01, Recovered from Channel Catfish

Reichley

Waldbieser²,

Tekedar

et al. 2015

Genome Announc

Self Cite

View full text Add to dashboard Cite

show abstract

Complete Genome Sequence of Channel Catfish Gastrointestinal Septicemia Isolate Edwardsiella tarda C07-087

Cited by 22 publications

References 12 publications

Histologic and molecular characterization of Edwardsiella piscicida infection in largemouth bass (Micropterus salmoides)

Histologic and molecular characterization of Edwardsiella piscicida infection in largemouth bass (Micropterus salmoides)

Edwardsiella Species Infection in Fish Population and Its Status in Ethiopia

Complete Genome Sequence of Edwardsiella tarda Isolate FL95-01, Recovered from Channel Catfish

Contact Info

Product

Resources

About