16S rRNA region based PCR protocol for identification and subtyping of Parvimonas micra

Ota-Tsuzuki, Cláudia; Brunheira, A.T.P.; Mayer, Márcia Pinto Alves

doi:10.1590/s1517-83822008000400001

Cited by 7 publications

(4 citation statements)

References 15 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…Reportedly, the level of P. micra and other bacteria in smokers' oral cavity is higher than that of nonsmokers. [16][17][18] In this study, we found that most of the patients with chronic lung abscess associated with P. micra had a long history of smoking. Hence, we speculated that long-term smoking might increase the risk of chronic lung abscess associated with P. micra.…”

Section: Discussionmentioning

confidence: 63%

Clinical Characteristics of Chronic Lung Abscess Associated with Parvimonas micra Diagnosed Using Metagenomic Next-Generation Sequencing

Zhang¹,

Song²,

Zhang³

et al. 2021

IDR

View full text Add to dashboard Cite

Parvimonas micra (P. micra) is a Gram-positive anaerobic bacterium distributed in the oral cavity, with a potential to become pathogenic causing lung abscess. Due to the lack of specificity of symptoms and the difficulty in culture, the diagnosis of lung abscess associated with P. micra is delayed. It is essential to elucidate the clinical characteristics of lung abscess associated with P. micra. Methods: From January 2019 to July 2020, five patients with chronic lung abscess associated with P. micra diagnosed by pathological biopsy and metagenomic next-generation sequencing (mNGS) were analyzed in this retrospective study. Results: Among the five patients, four had a history of smoking, three had periodontitis, and two had a history of drinking. The average course of the disease was 6.5 months. Highdensity flake-like or mass shadows with irregular boundaries were observed in the chest computed tomography (CT) images of the five patients, and liquefactive necrosis was detected in the middle of the lesions; however, no gas-liquid plane or cavity was noted, making it difficult to distinguish a lung cancer. The pathological biopsy of the five patients showed chronic inflammation of lung tissue, and P. micra was detected by mNGS in the biopsy or bronchoalveolar lavage fluid samples. Two patients were treated with amoxicillinclavulanate, two had metronidazole, and one had moxifloxacin. Among them, four recovered after receiving antibiotic treatment, and the remaining one underwent surgical resection due to poor antibiotic treatment effect. Conclusion: Chronic lung abscess associated with P. micra, common in elderly male smokers with poor oral hygiene, is often diagnosed in a delayed manner and misdiagnosed as lung cancer. The mNGS technology is beneficial to the rapid determination of P. micra.

show abstract

Section: Discussionmentioning

confidence: 63%

Clinical Characteristics of Chronic Lung Abscess Associated with Parvimonas micra Diagnosed Using Metagenomic Next-Generation Sequencing

Zhang¹,

Song²,

Zhang³

et al. 2021

IDR

View full text Add to dashboard Cite

show abstract

“…The DNA of bacterial isolates were amplified with the universal primers fD1 (5'AGAGTTTGATCCTGGCTCAG3') and rP2(5'ACGGCTACCTTGTTACGACTT3') (Tsuzuki et al, 2008). Polymerase chain reaction was performed in 50-µL reaction volume containing 100 ng DNA, 25 µL Maxima Hot Start PCR Master Mix and 20 µM of forward and reverse primers.…”

Section: Amplification and Sequencing Of 16s Rrna As Universal Genementioning

confidence: 99%

Morphological, Biochemical and Molecular Identification of 25 Rhizobium Leguminosarum Isolates From Faba Bean in Menofia Governorate, Egypt

Elhoshi

Eissa

El-Zanaty

2023

Menoufia Journal of Agricultural Biotechnology

View full text Add to dashboard Cite

We collected root nodules of faba bean plants from nine different area in Menofia Governorate. Twenty five isolates were collected from faba bean as a host trap. We identified our tested isolates for morphological characteristics (motility, carbol fuchsin stain and gram stain) and biochemical characteristics (acid or alkli production, utilization of different carbon sources, pH and NaCl tolerance, and starch and urea hydrolysis). We tested them on molecular level by amplification of 16s rRNA gene. All tested isolates came to be motile, gram-negative, not able to absorb Congo red. Results of biochemical testes showed that all tested isolates were acid producers, fast growers, able to survive on NaCl concentration ranging from 0.5 to 5%. All of them were able to grow in presence of wide range of pH (5 to 8). 16s rRNA gene came to be same size (about 1500 bp) in all Rhizobial isolates.

show abstract

“…The DNA of the Rhizobium isolates was amplified using the universal primers, fD1 (5' AGAGTTTGATCCTGG CTCAG 3') and rP2 (5' ACGGCTACCTTGTTA CGACTT 3') as described in Tsuzuki et al, [15]. The PCR reaction was performed in 50-μL reaction volume containing 100 ng DNA, 25 μL Maxima Hot Start PCR Master Mix (Fermentas, Lithuania) and 20 µM of forward and reverse primers.…”

Section: Amplification Of 16s Rrna Genementioning

confidence: 99%

“…The 16S rRNA gene was amplified using fD1 and rP2 primers as described by Tsuzuki et al [15], and all the isolates yielded a single-fragment about 850 bp. After amplification the same primers were used for partial sequencing of 16S rRNA region from the both sides.…”

Section: Amplification and Sequencing Of 16s Rrna Genementioning

confidence: 99%

Molecular Identification of Rhizobium Isolates Nodulating Faba Bean Plants in Egyptian Soils

Elsobky¹

2015

J Bioprocess Biotech

View full text Add to dashboard Cite

Eleven isolates of Rhizobium leguminosarum symbiovar. Viciae were isolated from root nodules of Vicia faba L. cultivated in 11 fields and represent different governorates in Egypt. The genetic diversity among the isolates was studied using the 16S rRNA gene partial sequence. The phylogenetic analysis formed two groups of isolates and the values of genetic distances were variable among the studied isolates. The highest value of genetic distance was between the isolates RL6 of North Sinai and RL8 of Dakhalia, while the lowest value was between isolates RL9 of Giza and RL10 of Sharkia. The isolates were evaluated for their tolerance to heavy metals using concentrations of 0.5, 1 and 2 mM of heavy metals (Cu, Pb and Zn). The ability to resist the heavy metals decreased with increase in concentration. At the highest concentration (2 mM), No growth was obtained with addition of Zn and Mn to the growth media, however only 27% of isolates could survive with the same concentration of Pb.

show abstract

16S rRNA region based PCR protocol for identification and subtyping of Parvimonas micra

Abstract: The present study established a PCR protocol in order to identify Parvimonas micra and to evaluate the intra-species diversity by PCR-RFLP of 16S rRNA partial sequence. The data indicated that the protocol was able to identify this species which could be clustered in five genotypes.

Cited by 7 publications

References 15 publications

Clinical Characteristics of Chronic Lung Abscess Associated with Parvimonas micra Diagnosed Using Metagenomic Next-Generation Sequencing

Clinical Characteristics of Chronic Lung Abscess Associated with Parvimonas micra Diagnosed Using Metagenomic Next-Generation Sequencing

Morphological, Biochemical and Molecular Identification of 25 Rhizobium Leguminosarum Isolates From Faba Bean in Menofia Governorate, Egypt

Molecular Identification of Rhizobium Isolates Nodulating Faba Bean Plants in Egyptian Soils

Contact Info

Product

Resources

About