Response of Paenibacillus polymyxa to iron: alternations in cellular chemical composition and the production of fusaricidin type antimicrobial compounds

Abstract

In this work, growth, cellular chemical composition and production of fusaricidin type antimicrobial compounds by P. polymyxa SQR-21 were compared in tryptone broth supplemented with four concentrations of iron (25, 50, 100 and 200 µM). The data revealed that the growth of P. polymyxa SQR-21 was increased by 3-8% with the increase in concentration of ferric ion (Fe 3+ [3][4][5][6][7][8][9][10][11][12][13] respectively, up to 50 µM Fe 3+ , after that a continuous decrease was observed.

Biocontrol of Fusarium Crown and Root Rot and Promotion of Growth of Tomato byPaenibacillusStrains Isolated from Soil

“…These microorganisms make siderophores available for their own and other species in the soil microbial community, and act indirectly as the biocontrol agents of plant pathogens [ 27 ]. Raza et al [ 28 ] showed that the addition of Fe 3+ , up to a certain concentration, increases the growth of P. ploymyxa SQR-21 and the production of fusaricidin-type compounds. In the current study, all strains produced siderophores, which is an important feature for the suppression of plant pathogens and the promotion of plant growth.…”

Optimization, purification, characterization and antioxidant activity of an extracellular polysaccharide produced by Paenibacillus polymyxa SQR-21

“…In addition, they over looked the effect of metal ions which have been reported as an important factor for the cellular functions of bacteria. During growth, metal ions as well as their oxide minerals influence the types and quantity of polysaccharides, proteins and enzymes secreted by bacteria (Raza et al, 2010c). We determined the effect of seven metal ions in previous reports and found four metal ions having significant effect on the promotion of EPS production by SQR-21.…”

Biocontrol traits of two Paenibacillus polymyxa strains SQR‐21 and WR‐2 in response to fusaric acid, a phytotoxin produced by Fusarium species

“…Antimicrobial compound production is one of the most important biocontrol traits of antagonistic microbes. The P. polymyxa strains used in this experiment were only able to produce four kinds of fusaricidin‐type antifungal compounds (Raza et al ., ) and experiments showed that the production ratio of four fusaricidins was not affected by FA. The results showed that the production of fusaricidins continuously increased with increasing FA concentration up to 40 and 50 μ g mL −1 for WR‐2 and SQR‐21, respectively.…”

“…The total RNA was estimated (260 nm) after 10 U DNaseI (TaKaRa) treatment. Specific primers for fusA (111 bp product) and 16S rRNA gene (210 bp product) were as follows: fusA1, 5′‐GCAGAGGATGATAGTGTTGGTC‐3′; fusA2, 5′‐CAGCACATCATGCGTTCC‐3′; 16s1, 5′‐CATTCATCGTTTACGGCGT‐3′; and 16s2, 5′‐TGTTAATCCCGAGGCTCACT‐3′ (Raza et al ., b). The first strand cDNA was prepared and target genes were amplified separately to check the band intensity and cDNA quality.…”