An improved method for characterization of the mutation associated to porcine stress syndrome by PCR amplification followed by restriction analysis

Luerce, Tessália Diniz; Galli, Vanessa; Cerqueira, Gustavo M.; Simionatto, Simone; Dellagostin, Odir Antônio

doi:10.1590/s0103-84782009000500044

Cited by 1 publication

(1 citation statement)

References 9 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…PCR was performed with a 5′‐CCACACCCTCCCCGCAAGTGC‐3′ forward primer and with a 5′‐GCCAGGGAGCAAGTTCTCAGTAAT‐3′ reverse primer. The PCR conditions used were described by Luerce et al . PCR products (144 bp) were digested at 37°C for 3 h with HhaI (Promega).…”

Section: Methodsmentioning

confidence: 99%

Treatment of long‐term stored DNA—Comparison between different methods to obtain high‐quality material

et al. 2013

View full text Add to dashboard Cite

Long-term stored DNA can be sometimes the only source of genetic material of an organism that does not exist anymore, but a research interest still persists. However, there is a lack of information about useful methods to improve quality from such type of material. In this study, we compared four different protocols using DNA samples collected in 1998. Fresh DNA was also tested aiming to check the differences between these two material types. Sixteen samples of each DNA type treated with phenol-chloroform with PEG 5.0%, silica-gel membrane spin column, PEG 7.5%, and glass-fiber matrix spin column were submitted to spectrophotometer measurements, electrophoresis, PCR, and RFLP-PCR to assess the best method concerning yield, quality, and purity. Based on the results, purification with PEG 7.5% was considered the best method to treat aged DNA samples. In addition to the efficiency, this protocol has low cost. Analyzing the data, we also conclude that long-term stored DNA may be considered a reliable and potential resource for future molecular studies.

show abstract

Section: Methodsmentioning

confidence: 99%

Treatment of long‐term stored DNA—Comparison between different methods to obtain high‐quality material

et al. 2013

View full text Add to dashboard Cite

show abstract

An improved method for characterization of the mutation associated to porcine stress syndrome by PCR amplification followed by restriction analysis

Abstract: An improved method for characterization of the mutation associated to porcine stress syndrome by PCR amplification followed by restriction analysis

Cited by 1 publication

References 9 publications

Treatment of long‐term stored DNA—Comparison between different methods to obtain high‐quality material

Treatment of long‐term stored DNA—Comparison between different methods to obtain high‐quality material

Contact Info

Product

Resources

About