Analysis of polymorphism at site -174 G/C of interleukin-6 promoter region in multiple myeloma

Abstract

It is well established that interleukin-6 (IL-6) is an essential growth factor for multiple myeloma (MM) and patients with increased IL-6 levels have a poor prognosis. In healthy subjects, the presence of the C allele at a polymorphic site (-174 G/C) of the IL-6 gene is related to low IL-6 levels. In view of the potential association of this particular polymorphism with IL-6 concentration, and the relevance of IL-6 in MM pathogenesis, the objective of the present study was to investigate the prevalence of IL-6 (-174 G/C) promoter polymorphism and its association with development of MM in Brazilian individuals. We investigated the prevalence of these alleles in 52 patients and 60 healthy subjects (matched by age, sex, and race) of a Brazilian population. Thirty patients were male (42.4%), 24 (46.2%) were white and the median age at diagnosis was 58.5 years (range: 28 to 84 years). To determine the IL-6 (-174 G/C) polymorphism, molecular analysis was performed by polymerase chain reaction followed by endonuclease restriction digestion. The genotype distributions observed in the group of patients were 4% CC, 42% GC and 54% GG. The C allele frequency was 0.25. These results were similar to the control group, suggesting no impact of this polymorphism on the susceptibility to MM.

Analysis of Polymorphism and Expression Profile of ASIC1 and IL-6 Genes in Patients with Gastric Cancer

“…The result of Litovkin et al, (2007) in the distribution of this polymorphism in Ukrainian patients with breast cancers or uterine leiomyosarcoma compared with those in Macedonia, Italy, and Finland showed significant differences in the−174 G/C allele. Analysis of the G allele frequency by Duch et al, (2007) in patients with multiple myeloma revealed that its frequency in the Brazilian population was higher than in the European population. In addition, another study showed a lower frequency of the G allele in Taiwanese patients with CRC than Caucasian populations (Yeh et al, 2010).…”

Association among interleukin‐6 gene polymorphisms, type 2 diabetes mellitus, and chronic periodontitis: a pilot study

“…Genotyping of the –174 region in the IL‐6 promoter was performed with polymerase chain reaction (PCR) and restriction fragment length polymorphism (RFLP) technique: IL‐6‐174: forward primer: 5′‐TTGTCAAGACATGCCAAAGTG‐3′; reverse primer: 5′‐TCAGACATCTCCAGTCCTATA‐3′ …”

“…Genotyping of the -174 region in the IL-6 promoter was performed with polymerase chain reaction (PCR) and restriction fragment length polymorphism (RFLP) technique: IL-6-174: forward primer: 5 0 -TTGTCAAGACATG CCAAAGTG-3 0 ; reverse primer: 5 0 -TCAGACATCTCCAG TCCTATA-3 0 . 8 Cycling was carried out as follows: initial denaturation at 94°C for 3 min, 32 cycles each at 94°C for 30 s, 55°C for 30 s, 72°C for 45 s, and one cycle at 72°C for 5 min. Digestion of PCR products with NIaIII (Neisseria lactamica) restriction endonuclease enzyme yielded 13 + 54 + 233 bp fragments in the (GG) homozygous state and 13 + 122 + 111 + 233 bp fragments in the (GC) heterozygous genotype.…”

Association between interleukin gene polymorphisms and multiple myeloma susceptibility

“…Most of the research was conducted within Caucasian communities: 10 studies in Caucasian populations (62.5%) (20,22,23,25,(33)(34)(35)(36)(37)(38), 3 within Asian populations (18.75%) (17,39,40) and 3 in Mixed Afro-American populations (18.75%) (24,41,42). Of note, the quantitative TaqMan method (TaqMan PCR) was often used to detect the SNP state with control references (11 studies, 68.75%) (20,(22)(23)(24)(25)(36)(37)(38)(39)41,42). Also, polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) method was used in 5 studies (31.25%) (17,(33)(34)(35)40).…”

“…The variables from sixteen relevant case-control studies were contained 2,597 cases and 3,851 controls. Source controls were mainly selected by population-based method with age/sex-matched (12 studies, 75%) (17,20,(23)(24)(25)33,34,36,38,(40)(41)(42). Regarding the NOS methodological quality, all included studies were of high quality with ≥7 out of 10 (mean 8.02 point).…”