Filaggrin silencing by shRNA directly impairs the skin barrier function of normal human epidermal keratinocytes and then induces an immune response

Abstract

The objective of this study was to investigate whether a single defect in skin barrier function simulated by filaggrin silencing could induce Th2-predominant inflammation. Filaggrin gene expression was silenced in cultured normal human epidermal keratinocytes (NHEKs) using small hairpin RNA (shRNA, GTTGGCTCAAGCATATTATTT). The efficacy of silencing was confirmed by polymerase chain reaction (PCR) and Western blotting. Filaggrin-silenced cells (LV group), shRNA control cells (NC group), and noninfected cells (Blank group) were evaluated. The expression of cornified cell envelope-related proteins, including cytokeratin (CK)-5, -10, -14, loricrin, involucrin, and transglutaminase (TGM)-1, was detected by Western blotting. Interleukins (IL)-2, IL-4, IL-5, IL-12p70, IL-13, and interferon-gamma (IFN-γ) were detected by enzyme-linked immunosorbent assay (ELISA). After filaggrin was successfully silenced by shRNA, the expressions of CK-5, -10, -14, involucrin, and TGM-1 in NHEKs were significantly downregulated compared to the Blank and NC groups (P<0.05 or P<0.01); only loricrin expression was markedly upregulated (P<0.01). Filaggrin silencing also resulted in significant increases of IL-2, IL-4, IL-5, and IL-13 (P<0.05 or P<0.01), and significant decreases of IL-12p70 and IFN-γ (P<0.01) compared with cells in the Blank and NC groups. Filaggrin silencing impaired normal skin barrier function mainly by targeting the cornified cell envelope. The immune response after filaggrin silencing was characterized by Th2 cells, mainly because of the inhibition of IFN-γ expression. Lack of filaggrin may directly impair skin barrier function and then further induce the immune response.

From the morphological to the transcriptomic characterization of a compromised three-dimensional in vitro model mimicking atopic dermatitis

“…The greatest known genetic risk factor is FLG‐null mutation. As this protein aggregates keratin in cornified cell envelopes and enables the compaction of squames and integrity of the stratum cornuem, its deficiency – in combination with abnormalities in both lipid chain length and other important proteins – leads to a functional epidermal barrier defect, followed by increased water loss, antigen sensitization and finally inflammation …”

“…As this protein aggregates keratin in cornified cell envelopes and enables the compaction of squames and integrity of the stratum cornuem, [8][9][10][11] its deficiencyin combination with abnormalities in both lipid chain length [12][13][14] and other important proteins leads to a functional epidermal barrier defect, followed by increased water loss, antigen sensitization and finally inflammation. [15][16][17][18][19][20] AD skin is therefore characterized primarily by the overexpression of proinflammatory molecules such as interleukin (IL)-4, IL-8, IL-13 and thymic stromal lymphopoietin (TSLP). 21,22 IL-4 and IL-13 are T helper (Th)2 cytokines, 23,24 IL-8 is an inflammatory cytokine classically secreted by immune cells after antigen sensitization, 25 and TSLP is an epithelial-cell-derived IL-7-like cytokine induced by antigen sensitization, immune-response-induced Th2 cytokines or Toll-like receptor (TLR) ligation.…”

Review of Soybean Phytochemicals and Their Bioactive Properties Relevant for Skin Health

“…In the study, a mixture of soy peptides and collagen peptides increased Type I collagen gene expression after 24 h of treatment, while downregulation was seen for Smad7 and MMP-1 gene expression (two factors that are responsible for collagen degradation). Filaggrin and involucrin are two other proteins that help maintain the barrier function of human skin [28,29]. The induction of ichthyosis vulgaris and allergen response has been reportedly associated with loss-of-function mutations in the filaggrin gene, resulting in defective barrier functioning [28,30,31].…”

Photoaging Protective Effects of Ranunculus bulumei Methanol Extract

“…In addition, UV acts directly on keratinocytes to increase melanogenesis through upregulation of receptor expression for melanocyte-stimulating hormone (MSH) and induction of tyrosinase gene expression, which leads to pigmentation and age spots [6]. In aged skin, the expression of skin barrier factors FLG and TGM and the skin moisturizing factor hyaluronic acid synthase (HAS-1, 2, 3) is decreased, resulting in dry skin and loss of skin elasticity [7,8].…”