Numerous studies have demonstrated that targeting Ag to Fc receptors (FcR) on APCs can enhance humoral and cellular immunity. However, studies are lacking that examine both the use of FcR-targeting in generating immune protection against infectious agents and the use of FcRs in the induction of mucosal immunity. Francisella tularensis is a category A intracellular mucosal pathogen. Thus, intense efforts are underway to develop a vaccine against this organism. We hypothesized that protection against mucosal infection with F. tularensis would be significantly enhanced by targeting inactivated F. tularensis live vaccine strain (iFt) to FcRs at mucosal sites, via intranasal immunization with mAb-iFt complexes. These studies demonstrate for the first time that: 1) FcR-targeted immunogen enhances immunogen-specific IgA production and protection against subsequent infection in an IgA-dependent manner, 2) FcγR and neonatal FcR are crucial to this protection, and 3) inactivated F. tularensis, when targeted to FcRs, enhances protection against the highly virulent SchuS4 strain of F. tularensis, a category A biothreat agent. In summary, these studies show for the first time the use of FcRs as a highly effective vaccination strategy against a highly virulent mucosal intracellular pathogen.
Plasmids encoding various external guide sequences (EGSs) were constructed and inserted into Escherichia coli. In strains harboring the appropriate plasmids, the expression of fully induced 18-galactosidase and alkaline phosphatase activity was reduced by more than 50%, while no reduction in such activity was observed in strains with nonspecific EGSs. The The potential value of ribozymes (e.g., RNase P, hammerhead, hairpin) as therapeutic agents is a direct consequence of their ability to catalyze sequence-specific cleavage of targeted RNAs in vitro (1). To date, the hairpin and hammerhead ribozymes have also been used with some success to cleave specific mRNAs in tissue culture (2-7). Moreover, RNase P from both Escherichia coli and human tissue can inhibit gene expression in mammalian cells in tissue culture (8,9). In contrast to experiments with eukaryotic cells, mixed results have been obtained for targeted cleavage by hammerhead ribozymes of mRNAs in E. coli (10-12). We show here that RNase P can be used to regulate the expression of several genes in E. coli.The main physiological role of RNase P, an essential enzyme (EC 3.1.26.5), is to cleave precursor tRNAs (ptRNAs) to generate the 5' termini of mature tRNA molecules (13). The enzyme in E. coli is a ribonucleoprotein in which the RNA moiety (Ml RNA) is the catalytic subunit (14) BL21(DE3)A49, which is similar to NHY322, A(proB-lac), ara, gyrA, thi, zic-501::TnlO, rnpA49 (20, 21); and E. Cali PP113(A49), recA, lacZam, rnpA49 (18). T7A49 was constructed by phage P1 transduction with NHY322 as the donor and BL21(DE3) as the recipient, with selection not only for tetracycline resistance (TetR) and temperature sensitivity (the donor's markers) but also for f3-galactosidase and T7 RNA polymerase activity (the recipient's markers).Plasmids. To construct genes for EGSs under the control of phage T7 RNA polymerase, inserts were cloned into pUC19 that lacked a Pvu II-Pvu II fragment of 322 bp. DNA oligonucleotides containing the sequences for the T7 promoter, the various EGSs used, and a hammerhead core of 57 nucleotides (CCAGGUCACCGGAUGUGCUUUCCGGUCUGAUGA-GUCCGUGAGGACGAAACCUGGAUC; the underlined sequence is the 3' terminus of the EGS) were ligated'to a BamHI-HindIII fragment that contained the T7 terminator sequence. This DNA fragment was obtained from pET3040 (22). Plasmid DNAs that contained the new inserts were obtained from transformants and subjected to sequence analysis to verify that the expected sequences were present. The following plasmids were obtained: pNT7DSlHH (coding for DS1-EGS, directed against f3-galactosidase mRNA); pNT7APHH (coding for AP-EGS, directed against alkaline phosphatase mRNA); and pNT7CIHH and pNT7NHH (coding for EGSs directed against phage A CI'and N mRNAs, respectively). Plasmid pBRCCA was a generous gift from N. B. ,ug/ml) were diluted to OD600 = 0.05 in LBC and the cultures were incubated at 30°C for about 3 h. The cells were then harvested and resuspended in phosphate-free P medium (23) supplemented with carbenicillin...
CD8+ cytotoxic T lymphocytes (CTL) recognize antigens (Ag) associated with class I major histocompatibility complex (MHC) molecules. Endogenously synthesized protein Ag are processed into peptides in the cytoplasm and transported to the endoplasmic reticulum where they are bound by class I proteins. Exogenous Ag do not enter the class I processing pathway of most cells and thus do not activate CD8+ CTL. Nevertheless, several investigators have reported that immunization with exogenous Ag can activate CD8+ T cells that have immunoregulatory activity. To determine how exogenous Ag entered the class I pathway in vivo and whether immunosuppressive CD8+ T cells were cytolytic, we have shown in this report that injection with OVA emulsified in the complete Freund's adjuvant (CFA) primed CD8+, class I MHC-restricted, OVA-specific CTL in mice. These CTL recognize the OVA257-264 epitope, produce tumor necrosis factor-alpha and interferon-gamma upon activation. Both oil and mycobacteria components in CFA were required for inducing CTL responses. Priming was not attributed to direct sensitization of class I-bearing cells by contaminating peptides. Rather, phagocytic cells, but not CD4+ helper T cells, were required for priming CD8+ CTL by OVA-CFA. Thus, OVA in CFA is taken up by antigen-presenting cells and processed into the class I pathway by phagocytic cells in vivo. In addition, CTL induced by OVA-CFA suppressed the antibody response to OVA in adoptive recipients. These results suggest that CD8+ CTL specific for exogenous proteins might be routinely stimulated by injecting proteins in conventional adjuvants and that such cells have the potential to regulate immune responses in vivo.
Viral RNAs produced during viral infection are recognized by the cytoplasmic RNA helicases retinoic acid-inducible gene-I (RIG-I) and melanoma differentiation-associated gene 5 (MDA5). A central adapter protein downstream of RIG-I and MDA5 is the mitochondrial membrane protein virus-induced signaling adaptor (VISA), which mediates the induction of type I interferons (IFNs) through the activation of transcription factors such as nuclear factor-kappaB (NF-kB) and IFN-regulatory factor-3 (IRF3). Here we found that hepatitis B virus (HBV)-encoded X protein (HBx) acts as an inhibitor of virus-triggered IRF3 activation and IFN-b induction. Reporter and plaque assays indicate that HBx inhibits signaling by components upstream but not downstream of VISA. Immunoprecipitation experiments indicate that HBx interacts with VISA and disrupts the association of VISA with its upstream and downstream components. These findings suggest that HBx acts as a suppressor of virus-triggered induction of type I IFNs, which explains the observation that HBV causes transient and chronic infection in hepatocytes but fails to activate the pattern recognition receptor-mediated IFN induction pathways.
Dual-template method was proposed to synthesize multiscale porous Fe–N–C catalysts, which exhibited a superior ORR performance in comparison with that of commercial Pt/C.
A self-powered electrochromic device (ECD) powered by a self-rechargeable battery is easily fabricated to achieve electrochromic window design, quantitative reactive oxygen species (ROS) sensing, and energy storage. The special design of the battery was composed of Prussian blue (PB) and magnesium metal as the cathode and anode, respectively, which exhibits fast self-charging and high power-density output for continuous and stable energy supply. Benefitting from the fast electrochromic response of PB, it was not only used for structuring self-rechargeable batteries but also used as an electrochromic display for highly sensitive self-powered ROS sensing and visual analysis. We believe that this work provides a solution to selfpowered ECDs limited to a single application and could combine the applications in smart windows, ROS sensing, and other fields together, and in the meantime provide a solution for energy supply problems.
Knowledge of the response of cytochrome P450 1B1 (CYP1B1) to exposure to 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD) in both humans and rodents is limited. To improve the analysis of CYP1 proteins, specific CYP1B1 and CYP1A1 polypeptides were expressed as hexahistidine-tagged fusion proteins in Escherichia coli, purified to homogeneity and used to produce polyclonal antibodies in rabbits. Immunoblot analyses showed that these antibodies were specific and sensitive, detecting both the human and rat forms of the respective isozymes and exhibiting negligible cross-reactivity between the two known CYP1 subfamilies. We show that CYP1B1, CYP1A1 and CYP1A2 protein levels were induced in the livers of female Sprague-Dawley rats following either acute (single dose of 25 microg TCDD/kg) or chronic (125 ng TCDD/kg/day for 30 weeks) exposure to TCDD. CYP1B1 protein exhibited a dose-response to TCDD that was different from those of CYP1A1 and CYP1A2. CYP1B1 induction appeared to be less sensitive to TCDD exposure, with induction occurring at higher doses of TCDD than that required for induction of CYP1A1 or CYP1A2. Immunohistochemical analysis showed that in animals chronically exposed to TCDD (35 ng/kg/day for 30 weeks), CYP1B1 was induced only in centrilobular hepatocytes, a pattern of expression similar to that of CYP1A1 and CYP1A2. These observations of cellular co-localization of the CYP1 cytochromes in livers of TCDD-treated rats and apparent differences in both protein amounts and dose-response are indicative of both common and unique regulation of CYP1 induction.
scite is a Brooklyn-based organization that helps researchers better discover and understand research articles through Smart Citations–citations that display the context of the citation and describe whether the article provides supporting or contrasting evidence. scite is used by students and researchers from around the world and is funded in part by the National Science Foundation and the National Institute on Drug Abuse of the National Institutes of Health.
hi@scite.ai
10624 S. Eastern Ave., Ste. A-614
Henderson, NV 89052, USA
Copyright © 2024 scite LLC. All rights reserved.
Made with 💙 for researchers
Part of the Research Solutions Family.