The amount of geranylgeranyl diphosphate (GGPP) is vital for microbial production of geranylgeraniol (GGOH) in Saccharomyces cerevisiae. In this study, a GGPP synthase with stronger catalytic ability was used to increase the supply of GGPP, and an engineered strain producing 374.02 mg/L GGOH at the shake flask level was constructed. Then, by increasing the metabolic flux of the mevalonate (MVA) pathway and the supply of isopentenyl pyrophosphate (IPP), the titer was further increased to 772.98 mg/L at the shake flask level, and we achieved the highest GGOH titer to date of 5.07 g/L in a 5 L bioreactor. This is the first report on the utilization of isoprenol for increasing the amount of IPP and enhancing GGOH production in S. cerevisiae. In the future, these strategies and engineered strains can be used to enhance the production of other terpenoids in S. cerevisiae.

In this study, a hypothetical lipase gene from Thermomicrobium roseum DSM 5159 (GenBank: ACM04789.1) was recombinantly expressed and characterized. The gene was inserted into two different plasmids (pTIG and pMA5...

In this study, a method for the efficient production of dehydroepiandrosterone (DHEA) from phytosterols in a vegetable oil/aqueous two-phase system by Mycobacterium sp. was developed. After the 3-hydroxyl group of phytosterols was protected, they could be converted into DHEA with high yield and productivity by Mycobacterium sp. NRRL B-3683. In a shake flask biotransformation, 15.05 g l of DHEA and a DHEA yield of 85.39% (mol mol) were attained after 7 days with an initial substrate concentration of 25 g l. When biotransformation was carried out in a 30-l stirred bioreactor with 25 g l substrate, the DHEA concentration and yield was 16.33 g l and 92.65% (mol mol) after 7 days, respectively. The results of this study suggest that inexpensive phytosterols could be utilized for the efficient production of DHEA.

The lipase TrLipB from Thermomicrobium roseum is highly thermostable. However, its thermostable skeleton and mechanism of action should be investigated for industrial applications. Toward this, TrLipB was crystallized using the hanging-drop vapor diffusion method and subjected to Xray diffraction at 2.0 Å resolution in this study. The rigid sites, such as the prolines on the relatively flexible loops on the enzyme surface, were scanned. Soft substitutions of these sites were designed using both molecular dynamics (MD) simulation and site-directed mutagenesis. The thermostability of several substitutions decreased markedly, while the catalytic efficiencies of the P9G, P127G, P194G, and P300G mutants reduced substantially; additionally, the thermostable framework of the double mutant, P194G/P300G, was considerably perturbed. However, the substitutions on the lid of the enzyme, including P49G and P48G, promoted the catalytic efficiency to approximately 150% and slightly enhanced the thermostability below 80 °C. In MD simulations, the P100G, P194G, P100G/P194G, P194G/ P300G, and P100G/P194G/P300G mutants showed high B-factors and RMSD values, whereas the secondary structures, radius of gyration, H-bonds, and solvent accessible surface areas of these mutants were markedly affected. Our observations will assist in understanding the natural framework of a stable lipase, which might contribute to its industrial applications.

With numerous industrial applications, Paenibacillus polymyxa has been accepted as the candidate of the cell factory for many secondary metabolites. However, as the regulatory expression elements in P. polymyxa have not been systematically investigated, genetic modification on account of a specific metabolism pathway for the strain is limited. In this study, a xylose-inducible operon in the xylan-utilizing bacterium ATCC842 was identified, and the relative operon transcription was increased to 186-fold in the presence of xylose, while the relative enhanced green fluorescent protein (eGFP) fluorescence intensity was promoted by over four-fold. By contrast, glucose downregulated the operon to 0.5-fold that of the control. The binding site of the operon was “ACTTAGTTTAAGCAATAGACAAAGT”, and this can be degenerated to “ACTTWGTTTAWSSNATAVACAAAGT” in Paenibacillus spp., which differs from that in the Bacillus spp. xylose operon. The xylose operon binding site was transplanted to the constitutive promoter Pshuttle-09. The eGFP fluorescence intensity assay indicated that both the modified and original Pshuttle-09 had similar expression levels after induction, and the expression level of the modified promoter was decreased to 19.8% without induction. This research indicates that the operon has great potential as an ideal synthetic biology tool in Paenibacillus spp. that can dynamically regulate its gene circuit strength through xylose.

TrLipE is a thermophilic lipase that has potential commercial applications because of its catalytic ability under extreme conditions. Consistent with most lipases, the lid of TrLipE is located over the catalytic pocket, controls the substrate channel to the active center, and regulates the substrate specificity, activity, and stability of the enzyme through conformational changes. TrLipE from Thermomicrobium roseum has potential industrial applications, which is hindered by its weak enzymatic activity. Here, 18 chimeras (TrL1-TrL18) were reconstructed by N-terminal lid swapping between TrLipE and structurally similar enzymes. The results showed that the chimeras had a similar pH range and optimum pH as wild TrLipE but a narrower temperature range of 40–80°C, and TrL17 and the other chimeras showed lower optimum temperatures of 70°C and 60°C, respectively. In addition, the half-lives of the chimeras were lower than those of TrLipE under optimum temperature conditions. Molecular dynamics simulations indicated that chimeras had high RMSD, RMSF, and B-factor values. When p-nitrophenol esters with different chains were used as substrates, compared with TrLipE, most of the chimeras had a low Km and high kcat value. The chimeras TrL2, TrL3, TrL17, and TrL18 could specifically catalyze the substrate 4-nitrophenyl benzoate, with TrL17 showing the highest kcat/Km value of 363.88 ± 15.83 L⋅min–1⋅mmol–1. Mutants were then designed by investigating the binding free energies of TrL17 and 4-nitrophenyl benzoate. The results indicated that single, double, and triple substitution variants (M89W and I206N; E33W/I206M and M89W/I206M; and M89W/I206M/L21I and M89W/I206N/L21I, respectively) presented approximately 2- to 3-fold faster catalysis of 4-nitrophenyl benzoate than the wild TrL17. Our observations will facilitate the development of the properties and industrial applications of TrLipE.

No abstract

No abstract