SummaryBacillus subtilis can serve as a powerful platform for directed evolution, especially for secretory enzymes. However, cloning and transformation of a DNA mutant library in B. subtilis are not as easy as they are in Escherichia coli. For direct transformation of B. subtilis, here we developed a new protocol based on supercompetent cells prepared from the recombinant B. subtilis strain SCK6 and multimeric plasmids. This new protocol is simple (restriction enzyme‐, phosphatase‐ and ligase‐free), fast (i.e. 1 day) and of high efficiency (i.e. ∼107 or ∼104 transformants per µg of multimeric plasmid or ligated plasmid DNA respectively). Supercompetent B. subtilis SCK6 cells were prepared by overexpression of the competence master regulator ComK that was induced by adding xylose. The DNA mutant library was generated through a two‐round PCR: (i) the mutagenized DNA fragments were generated by error‐prone PCR and linearized plasmids were made using high‐fidelity PCR, and (ii) the multimeric plasmids were generated based on these two DNA templates by using overlap PCR. Both protein expression level and specific activity of glycoside hydrolase family 5 endoglucanse on regenerated amorphous cellulose were improved through this new system. To our limited knowledge, this study is the first report for enhancing secretory cellulase performance on insoluble cellulose.
We developed a general restriction enzyme-free and ligase-free method for subcloning up to three DNA fragments into any location of a plasmid. The DNA multimer generated by prolonged overlap extension PCR was directly transformed in Escherichia coli [e.g., TOP10, DH5␣, JM109, and BL21(DE3)] and Bacillus subtilis for obtaining chimeric plasmids.T he limited choices of restriction enzymes, relatively low efficiencies in digestion and ligation, and possible self-ligation of the digested plasmid may result in difficulties in constructing chimeric plasmids. Recently, several companies have developed recombinase-based technologies, such as the Invitrogen Gateway cloning technology, Clontech In-Fusion, BioCat Cold-Fusion, and Red/ET Recombination, but these rely heavily on specialized kits containing vectors, enzymes, or hosts (4,7,10,11,14,15 Downloaded fromSeveral overlap extension PCR-based methods were developed for subcloning. However, RF cloning (9) and overlap extension PCR cloning (2) require DpnI to digest the vector template. Additionally, the maximum inserted DNA length is ϳ6.7 kb (2). Another technology, called "Quick Assemble," has low positive cloning efficiencies, ϳ33% (16). We developed a sequence-independent "simple cloning" method without the need for restriction and ligation enzymes. The protocol includes three steps ( Fig. 1): (i) linear DNA fragments (i.e., inserted DNA fragment and vector backbone), both of which contained 3= and 5= 40-to 50-bp overlapping termini, are generated by high-fidelity PCR with the New England BioLabs (NEB) Phusion polymerase (Ipswich, MA); (ii) the DNA multimer is generated based on these DNA templates by prolonged overlap extension PCR (POE-PCR) with Phusion polymerase; and (iii) the POE-PCR products (DNA multimer) are transformed into competent Escherichia coli or Bacillus subtilis strains directly, yielding the desired chimeric plasmid. A 1.3-kb insertion fragment (Cherry-cbm17) encoding a cherry fluorescent protein and a family 17 carbohydrate-binding module from Clostridium cellulovorans cellulase 5A (1) was subcloned into a 3.6-kb pET20b vector backbone, yielding a 4.9-kb plasmid, pET20b-cherry-cbm17, where the fusion protein was controlled by a T7 promoter. A linear vector backbone was amplified by using the forward primer VF (5=TAGCCTGGACAA TATCAAATTTACCCTCGAGCACCACCACCACCACCACT3=) and the reverse primer VR (5=TATCCTCCTCGCCCTTGCTCA CCATATGTATATCTCCTTCTTAAAGTTAA3=). VF and VR contain the last 25 bp of the 3= terminus of the insertion sequence (underlined) and the first 25 bp of the 5= terminus of the vector sequence (bold). Similarly, the insertion fragment was amplified by primers IF (5=TTAACTTTAAGAAGGAGATATACATATGG TGAGCAAGGGCGAGGAGGAT3=) and IR (5=AGTGGTGGTG GTGGTGGTGCTCGAGGGTAAATTTGATATTGTCCAGGCT A3=). IF and IR have the reverse complementary sequences of VR and VF, respectively. The standard extension time (SET) in PCR was calculated based on the amplified fragment length divided by 3 kb/min for Phusion polymerase at 72°C. Two linearized DNA fragments were ...
The global demand for food could double in another 40 y owing to growth in the population and food consumption per capita. To meet the world's future food and sustainability needs for biofuels and renewable materials, the production of starch-rich cereals and cellulose-rich bioenergy plants must grow substantially while minimizing agriculture's environmental footprint and conserving biodiversity. Here we demonstrate one-pot enzymatic conversion of pretreated biomass to starch through a nonnatural synthetic enzymatic pathway composed of endoglucanase, cellobiohydrolyase, cellobiose phosphorylase, and alpha-glucan phosphorylase originating from bacterial, fungal, and plant sources. A special polypeptide cap in potato alpha-glucan phosphorylase was essential to push a partially hydrolyzed intermediate of cellulose forward to the synthesis of amylose. Up to 30% of the anhydroglucose units in cellulose were converted to starch; the remaining cellulose was hydrolyzed to glucose suitable for ethanol production by yeast in the same bioreactor. Next-generation biorefineries based on simultaneous enzymatic biotransformation and microbial fermentation could address the food, biofuels, and environment trilemma.bioeconomy | food and feed | synthetic amylose | in vitro synthetic biology | cell-free biomanufacturing T he continuing growth of the population and food consumption per capita means that the global demand for food could increase by 50-100% by 2050 (1, 2), and ∼30% of the world's agricultural land and 70% of the world's fresh water withdrawals are being used for the production of food and feed to support 7 billion people (3, 4). Starch is the most important dietary component because it accounts for more than half of the consumed carbohydrates, which provide 50-60% of the calories needed by humans. Starch is composed of polysaccharides consisting of a large number of glucose units joined together primarily by alpha-1,4-glycosidic bonds and alpha-1,6-glycosidic bonds. Linear-chain amylose is more valuable than branched amylopectin because it can be used as a precursor for making high-quality transparent, flexible, low-oxygen-diffusion plastic sheets and films (5, 6); tailored functional food or additives for lowering the risk of serious noninfectious diseases (e.g., diabetes and obesity) (7, 8); and a potential high-density hydrogen carrier (9-11). Also, it is easy to convert linear amylose to branched amylopectin by using alphaglucan-branching glycosyltransferase (12).Cellulose, a linear glucan linked by beta-1,4-glycosidic bonds, is the supporting material of plant cell walls and the most abundant carbohydrate on Earth. The annual resource of cellulosic materials is ∼40 times greater than the starch produced by crops cultivated for food and feed. In addition, (perennial) cellulosic plants and dedicated bioenergy crops can grow on low-quality land, even on marginal land, and require fewer inputs such as fertilizers, herbicides, pesticides, and water, whereas annual high-productivity starch-rich crops require high-qual...
Here, we present a novel method for the directed genetic manipulation of the Bacillus subtilis chromosome free of any selection marker. Our new approach employed the Escherichia coli toxin gene mazF as a counter-selectable marker. The mazF gene was placed under the control of an isopropyl-beta-D-thiogalactopyranoside (IPTG)-inducible expression system and associated with a spectomycin-resistance gene to form the MazF cassette, which was flanked by two directly-repeated (DR) sequences. A double-crossover event between the linearized delivery vector and the chromosome integrated the MazF cassette into a target locus and yielded an IPTG-sensitive strain with spectomycin-resistance, in which the wild-type chromosome copy had been replaced by the modified copy at the targeted locus. Another single-crossover event between the two DR sequences led to the excision of the MazF cassette and generated a strain with IPTG resistance, thereby realizing the desired alteration to the chromosome without introducing any unwanted selection markers. We used this method repeatedly and successfully to inactivate a specific gene, to introduce a gene of interest and to realize the in-frame deletion of a target gene in the same strain. As there is no prerequisite strain for this method, it will be a powerful and universal tool.
The methyl parathion hydrolase (MPH)-encoding gene mpd was placed under the control of the P43 promoter and Bacillus subtilis nprB signal peptide-encoding sequence. High-level expression and secretion of mature, authentic, and stable MPH were achieved using the protease-deficient strain B. subtilis WB800 as the host.Organophosphate compounds are used extensively in agricultural and domestic pest control and as chemical warfare agents; these compounds inhibit the acetylcholinesterase of animals (8). Mass application of these compounds in the environment causes serious problems. Organophosphate hydrolase (OPH) isolated from soil microorganisms detoxified organophosphates effectively (14,18), and bioremediation of organophosphate compounds in the environment by using bacterial enzymes may provide an efficient, convenient, and economical method for detoxification. We previously isolated Plesiomonas sp. strain M6, which is capable of hydrolyzing methyl parathion at high efficiency (5), and the gene (mpd) encoding a novel methyl parathion hydrolase (MPH) was cloned (5) and expressed in Escherichia coli (9). However, the previous work showed that E. coli could process only a small proportion of the inactive precursor polypeptide, comprising the signal peptide and the mature enzyme, to produce the active MPH (9).Most microorganisms that produce OPH are gram-negative bacteria, and the OPH is located intracellularly or secreted into the periplasm. The outer membrane acts as a permeability barrier and limits interaction between the pesticides and OPH residing within the cells (12). This bottleneck reduces the application efficacy. Bacillus subtilis can serve as an efficient and safe host for recombinant protein secretion (3,4,7,16,17). Secreted proteins usually remain in biologically active forms (13,15), and downstream purification is greatly simplified. In this work, the mpd gene was fused with the nprB signal peptideencoding sequence, and the organophosphate hydrolase was expressed and secreted in B. subtilis under the control of the P43 promoter (20).The methyl parathion hydrolase-encoding gene mpd (GenBank accession no. AF338729) cannot be expressed in B. subtilis by using its own promoter. To achieve expression and secretion of MPH in B. subtilis, the secretion signal peptideencoding sequence of the nprB gene was fused with the mature mpd gene. A typical cleavage site (ASA-A) (19) for signal peptidase I was designed for the release from B. subtilis of MPH with an authentic N terminus (Fig. 1B). The mature mpd gene sequence (9) was cloned using the primer pair P1 (5Ј-G CGCTGCAGCACCGCAGGTG-3Ј) and P2 (5Ј-CGCAAGCT TTCATCATCACTTGGGGTTGACGACCGA-3Ј) from plasmid pMT1 (5). To introduce the PstI site (underlined) upstream, the codon GCC encoding the first amino acid of mature MPH was modified to GCA (Fig. 1B). Two additional stop codons (TGATGA) and the HindIII site (underlined) were introduced with primer P2. Primers P3 (5Ј-CGCGGAT CCTGATAGGTGGTATGTTTTCGC-3Ј) and P4 (5Ј-CTTG GTCAAGTTGCGCATGTGTACATTCCTCTCTT-3Ј) were used to ...
surface of the microorganisms . Only a few of the enzymes in cellulosomes contain a CBM, but most of them are attached to the scaffoldin protein that contains a CBM. Some anaerobic bacteria can produce cellulosomes and free cellulases ( Berger et al., 2007 ;Doi and Kosugi, 2004 ;Gilad et al., 2003 ). The architecture and function of cellulosomes have been well reviewed by many experts (
A cellulosome-microbe complex was assembled ex vivo on the surface of Bacillus subtilis displaying a miniscaffoldin that can bind with three dockerin-containing cellulase components: the endoglucanase Cel5, the processive endoglucanase Cel9, and the cellobiohydrolase Cel48. The hydrolysis performances of the synthetic cellulosome bound to living cells, the synthetic cellulosome, a noncomplexed cellulase mixture with the same catalytic components, and a commercial fungal enzyme mixture were investigated on low-accessibility recalcitrant Avicel and high-accessibility regenerated amorphous cellulose (RAC). The cellbound cellulosome exhibited 4.5-and 2.3-fold-higher hydrolysis ability than cell-free cellulosome on Avicel and RAC, respectively. The cellulosome-microbe synergy was not completely explained by the removal of hydrolysis products from the bulk fermentation broth by free-living cells and appeared to be due to substrate channeling of long-chain hydrolysis products assimilated by the adjacent cells located in the boundary layer. Our results implied that long-chain hydrolysis products in the boundary layer may inhibit cellulosome activity to a greater extent than the short-chain products in bulk phase. The findings that cell-bound cellulosome expedited the microbial cellulose utilization rate by 2.3-to 4.5-fold would help in the development of better consolidated bioprocessing microorganisms (e.g., B. subtilis) that can hydrolyze recalcitrant cellulose rapidly at low secretory cellulase levels.
One-step enzyme purification and immobilization were developed based on simple adsorption of a family 3 cellulose-binding module (CBM)-tagged protein on the external surface of high-capacity regenerated amorphous cellulose (RAC). An open reading frame (ORF) Cthe0217 encoding a putative phosphoglucose isomerase (PGI, EC 5.3.1.9) from a thermophilic bacterium Clostridium thermocellum was cloned and the recombinant proteins with or without CBM were over-expressed in Escherichia coli. The rate constant (kcat ) and Michaelis-Menten constant (Km ) of CBM-free PGI at 60°C were 2,765 s(-1) and 2.89 mM, respectively. PGI was stable at a high protein concentration of 0.1 g/L but deactivated rapidly at low concentrations. Immobilized CBM (iCBM)-PGI on RAC was extremely stable at ∼60°C, nearly independent of its mass concentration in bulk solution, because its local concentration on the solid support was constant. iCBM-PGI at a low concentration of 0.001 g/L had a half-life time of 190 h, approximately 80-fold of that of free PGI. Total turn-over number of iCBM-PGI was as high as 1.1×10(9) mole of product per mole of enzyme at 60°C. These results suggest that a combination of low-cost enzyme immobilization and thermoenzyme led to an ultra-stable enzyme building block suitable for cell-free synthetic pathway biotransformation that can implement complicated biochemical reactions in vitro.
scite is a Brooklyn-based organization that helps researchers better discover and understand research articles through Smart Citations–citations that display the context of the citation and describe whether the article provides supporting or contrasting evidence. scite is used by students and researchers from around the world and is funded in part by the National Science Foundation and the National Institute on Drug Abuse of the National Institutes of Health.
hi@scite.ai
10624 S. Eastern Ave., Ste. A-614
Henderson, NV 89052, USA
Copyright © 2024 scite LLC. All rights reserved.
Made with 💙 for researchers
Part of the Research Solutions Family.