Sustained NF-B activation produces a short-term cell proliferation block in conjunction with repressing effectors of cell cycle progression controlled by E2F or FoxM1. J Cell Physiol 218:215-227.In the originally published version of this article, J Cell Phys 218:215-227, the nucleotide sequences of three oligonucleotide primers appearing on page 218 have been determined to be inaccurate. The incorrectly published sequences and their corrected versions are published below to document the error. In conjunction with this erratum, the online files of the article have been amended accordingly and the updated article should be considered the version of record.J. Cell. Physiol. 224: 566, 2010. ß 2010 Wiley-Liss, Inc.Original sequences: IkBa R(GCTGGCCTCAAACACAC); Gapdh F(GACCCGCTTCATGCCTGG), Gapdh R (GGTGATGGTGTCCATCTGGAC).Corrected sequences: IkBa R(GCTGGCCTCCAAACACAC); Gapdh F(GCTCACTGGCATGGCCTTC), Gapdh R (CCTTCTTGATGTCATCATACTTGGC).
scite is a Brooklyn-based organization that helps researchers better discover and understand research articles through Smart Citations–citations that display the context of the citation and describe whether the article provides supporting or contrasting evidence. scite is used by students and researchers from around the world and is funded in part by the National Science Foundation and the National Institute on Drug Abuse of the National Institutes of Health.