The gene encoding IgH δ has been found in all species of teleosts studied to date. However, catfish (Ictalurus punctatus) is the only species of fish in which a secretory form of IgD has been characterized, and it occurs through the use of a dedicated δ-secretory exon, which is absent from all other species examined. Our studies have revealed that rainbow trout (Oncorhynchus mykiss) use a novel strategy for the generation of secreted IgD. The trout secretory δ transcript is produced via a run-on event in which the splice donor site at the end of the last constant domain exon (D7) is ignored and transcription continues until a stop codon is reached 33 nt downstream of the splice site, resulting in the production of an in-frame, 11-aa secretory tail at the end of the D7 domain. In silico analysis of several published IgD genes suggested that this unique splicing mechanism may also be used in other species of fish, reptiles, and amphibians. Alternative splicing of the secretory δ transcript resulted in two δ-H chains, which incorporated Cμ1 and variable domains. Secreted IgD was found in two heavily glycosylated isoforms, which are assembled as monomeric polypeptides associated with L chains. Secretory δ mRNA and IgD+ plasma cells were detected in all immune tissues at a lower frequency than secretory IgM. Our data demonstrate that secretory IgD is more prevalent and widespread across taxa than previously thought, and thus illustrate the potential that IgD may have a conserved role in immunity.

SBOP and RBOP induced retinal damage. RBOP caused more apoptosis in the optic nerve than SBOP, suggesting that RBOP causes more severe optic neuropathy than SBOP. SBOP and RBOP caused gliosis in the retina and increased inflammation in the optic nerve.

To generate BAC36⌬vF, a PCR product was first obtained with the primers 5Ј-GAGCACCCTGAAATCCAGGCTCTACAGGTAGGCCACATACGCTCGCCACTCTA TATGGTGTAGGCTGGAGCTGCTTC-3Ј (forward) and 5Ј-CCGCCCTAAACAAAATCACAAGCTTAATAGCTGTCCAGA ATGCGCAGATCAAAGTCCCATATGAATATCCTCCTTAG-3Ј (reverse), using plasmid pMS102-Zeocin as a template." should read "To generate BAC36⌬vF, a PCR product was first obtained with the primers 5ЈCCTTTGTTTTTCCACATCGGTG CCTTCACATATACAAGCCGGCACCATGGCCACTTACGTGTAGGCTGGAGCTGCTTC-3Ј (forward) and 5Ј-ATTAGCA ACAGCTTGTTATCTATGGTGTATGGCGATAGTGTTGGGAGTGTGATGGGCCATATGAATATCCTCCTTAG-3Ј (reverse), using plasmid pMS102-Zeocin as a template." 9655

BOP of 120 ± 7 KPa induces optic neuropathy and retinal damage. In both the optic nerve and retina, caspase 3 was activated in the right and left sides following blast exposure. The results of this study reveal that blast exposure induces apoptosis in both the optic nerve and retinal tissues.

Proliferative vitreoretinopathy (PVR) is the leading cause of retinal detachment surgery failure. Despite significant advances in vitreoretinal surgery, it still remains without an effective prophylactic or therapeutic medical treatment. After ocular injury or retinal detachment, misplaced retinal cells undergo epithelial to mesenchymal transition (EMT) to form contractile membranes within the eye. We identified Runt-related transcription factor 1 (RUNX1) as a gene highly expressed in surgically-removed human PVR specimens. RUNX1 upregulation was a hallmark of EMT in primary cultures derived from human PVR membranes (C-PVR). The inhibition of RUNX1 reduced proliferation of human C-PVR cells in vitro, and curbed growth of freshly isolated human PVR membranes in an explant assay. We formulated Ro5-3335, a lipophilic small molecule RUNX1 inhibitor, into a nanoemulsion that when administered topically curbed the progression of disease in a novel rabbit model of mild PVR developed using C-PVR cells. Mass spectrometry analysis detected 2.67 ng/mL of Ro5-3335 within the vitreous cavity after treatment. This work shows a critical role for RUNX1 in PVR and supports the feasibility of targeting RUNX1 within the eye for the treatment of an EMT-mediated condition using a topical ophthalmic agent.

iPS-RPE develops classic RPE characteristics and maintains expression of visual cycle proteins. The results of this study confirm that iPS-RPE possesses the machinery to process retinoids for support of visual pigment regeneration. Inhibition of all-trans retinyl ester accumulation by NEM confirms LRAT is active in iPS-RPE. Finally, the detection of 11-cis retinaldehyde in the culture medium demonstrates the cells' ability to process retinoids through the visual cycle. This study demonstrates expression of key visual cycle machinery and complete visual cycle activity in iPS-RPE.

The objective of this study was to document the pharmacokinetics of ketoprofen following 3 mg/kg intramuscular (IM) and intravenous (IV) injections in rainbow trout ( Oncorhynchus mykiss ) and 8 mg/kg intramuscular (IM) injection in Nile tilapia ( Oreochromis niloticus) . Plasma was collected laterally from the tail vein for drug analysis at various time intervals up to 72 h following the injection of ketoprofen. In trout, area under the curve (AUC) levels were 115.24 μg hr/mL for IM and 135.69 μg hr/mL for IV groups with a half-life of 4.40 and 3.91 h, respectively. In both trout and tilapia, there were detectable ketoprofen concentrations in most fish for 24 h post-injection. In tilapia, there was a large difference between the R- and S-enantiomers, suggesting either chiral inversion from R- to S-enantiomer or more rapid clearance of the R-enantiomer. AUC values of the S- and R-enantiomers were 510 and 194 μg hr/Ml, respectively, corresponding to a faster clearance for the R-enantiomer. This study shows that there were very high plasma concentrations of ketoprofen in trout and tilapia with no adverse effects observed. Future studies on the efficacy, frequency of dosing, analgesia, adverse effects, and route of administration are warranted.

The purpose of this study is to characterize the microRNA (miRNA) expression profiles of induced pluripotent stem (iPS) cells and retinal pigment epithelium (RPE) derived from induced pluripotent stem cells (iPS-RPE). MiRNAs have been demonstrated to play critical roles in both maintaining pluripotency and facilitating differentiation. Gene expression networks accountable for maintenance and induction of pluripotency are linked and share components with those networks implicated in oncogenesis. Therefore, we hypothesize that miRNA expression profiling will distinguish iPS cells from their iPS-RPE progeny. To identify and analyze differentially expressed miRNAs, RPE was derived from iPS using a spontaneous differentiation method. MiRNA microarray analysis identified 155 probes that were statistically differentially expressed between iPS and iPS-RPE cells. Up-regulated miRNAs including miR-181c and miR-129–5p may play a role in promoting differentiation, while down-regulated miRNAs such as miR-367, miR-18b, and miR-20b are implicated in cell proliferation. Subsequent miRNA–target and network analysis revealed that these miRNAs are involved in cellular development, cell cycle progression, cell death, and survival. A systematic interrogation of temporal and spatial expression of iPS-RPE miRNAs and their associated target mRNAs will provide new insights into the molecular mechanisms of carcinogenesis, eye differentiation and development.