Impaired microbiota enzymatic activity observed in IBD-associated dysbiosis leads to modifications in the luminal BA pool composition. Altered BA transformation in the gut lumen can erase the anti-inflammatory effects of some BA species on gut epithelial cells and could participate in the chronic inflammation loop of IBD.

Silver-Russell syndrome (SRS, OMIM 180860) is a congenital disorder characterized by severe intrauterine and postnatal growth retardation, dysmorphic facial features and body asymmetry. SRS is genetically heterogenous with maternal uniparental disomy with respect to chromosome 7 occurring in approximately 10% of affected individuals. Given the crucial role of the 11p15 imprinted region in the control of fetal growth, we hypothesized that dysregulation of genes at 11p15 might be involved in syndromic intrauterine growth retardation. We identified an epimutation (demethylation) in the telomeric imprinting center region ICR1 of the 11p15 region in several individuals with clinically typical SRS. This epigenetic defect is associated with, and probably responsible for, relaxation of imprinting and biallelic expression of H19 and downregulation of IGF2. These findings provide new insight into the pathogenesis of SRS and strongly suggest that the 11p15 imprinted region, in addition to those of 7p11.2-p13 and 7q31-qter, is involved in SRS.

Cirrhosis consists of hepatocyte nodules surrounded by a highly vascularized fibrous tissue. We previously showed that the development of biliary cirrhosis in the rat is associated with the occurrence of hepatocellular hypoxia and the induction of hepatic angiogenesis. We herein examined the occurrence of hypoxia in an experimental model of diethylnitrosamine (DEN)-induced cirrhosis. We also determined whether hypoxia directly affects the expression of vascular endothelial growth factor (VEGF), of VEGF receptors (Flt-1, Flk-1), and of type I and type IV collagens in activated hepatic stellate cells (HSCs) and the expression of VEGF in hepatocytes. Our results show that in DEN-treated rats, although the progression of liver fibrosis is associated with hepatocellular hypoxia and angiogenesis, VEGF and Flt-1 expressions in the liver are increased and correlated with the density of microvessels. In vitro, hypoxia induces the expression of VEGF, Flt-1, and type I collagen in activated HSCs and that of VEGF in hepatocytes. In addition, we show that hypoxia-induced type I collagen expression in HSCs may occur independently of transforming growth factor ␤1 (TGF-␤1) overexpression. In conclusion, the present study provides further evidence that hepatocellular hypoxia and angiogenesis progress together with fibrogenesis after liver injury and that hypoxia directly contributes to the progression of liver fibrosis. (HEPATOLOGY 2002;35: 1010-1021.)

No abstract

Epidermal growth factor receptor (EGFR) binds transforming growth factor ␣ (TGF-␣) which is mitogenic for hepatocytes. Diverse lines of evidence suggest that activation of the TGF-␣ /EGFR pathway contributes to hepatocellular carcinoma (HCC) formation. Herein, we developed an experimental model of cirrhosis giving rise to HCC and tested the antitumoral effect of gefitinib, a selective EGFR tyrosine kinase inhibitor, in this model. Rats received weekly intraperitoneal injections of diethylnitrosamine (DEN) followed by a 2-week wash-out period that caused cirrhosis in 14 weeks and multifocal HCC in 18 weeks. Hepatocyte proliferation was increased in diseased tissue at 14 weeks compared with control liver and at even higher levels in HCC nodules compared with surrounding diseased tissues at 18 weeks. Increased proliferation was paralleled by upregulation of TGF-␣ messenger RNA expression. A group of DEN-treated rats received daily intraperitoneal injections of gefitinib between weeks 12 and 18. In rats treated with gefitinib, the number of HCC nodules was significantly lower than in untreated rats (18.1 ؎ 2.4 vs. 3.7 ؎ 0.45; P < .05), while EGFR was activated to a lesser extent in the diseased and tumoral tissues of these animals compared with untreated rats. HCC nodules from both untreated and gefitinib-treated animals displayed insulin-like growth factor 2 overexpression that contributed to tumor formation in treated animals. In conclusion, the blockade of EGFR activity by gefitinib has an antitumoral effect on the development of HCC in DEN-exposed rats, suggesting that it may provide benefit for the chemoprevention of HCC. (HEPATOLOGY 2005;41:307-314.)

SUMMARY:The origin of myofibroblasts and the factors promoting their differentiation during liver fibrogenesis remain uncertain. During biliary-type fibrogenesis, the proliferation and chemoattraction of hepatic stellate cells (HSC) toward bile ducts is mediated by platelet-derived growth factor (PDGF), while myofibroblastic conversion of peribiliary cells distinct from HSC also occurs. We herein examined the phenotype of these peribiliary myofibroblasts as compared with myofibroblastic HSC and tested whether their differentiation was affected by PDGF. Biliary-type liver fibrogenesis was induced by common bile duct ligation in rats. After 48 hours, periductular fibrosis in portal tracts colocalized with smooth muscle ␣-actin-immunoreactive myofibroblasts, the majority of which were desmin negative. Simultaneously, in sinusoids, desmin immunoreactivity was induced in a large number of HSC, which were smooth muscle ␣-actin negative. Cultures of peribiliary myofibroblasts were expanded from isolated bile duct segments and compared with myofibroblastic HSC. Peribiliary myofibroblasts outgrowing from bile duct segments expressed smooth muscle ␣-actin, ␣1 (I) collagen mRNA, and PDGF receptor-␤ subunit. Desmin immunoreactivity gradually decreased in cultured peribiliary myofibroblasts, contrasting with constant labeling of all myofibroblastic HSC. In addition, IL-6 expression in peribiliary myofibroblasts was up to 100-fold lower than in myofibroblastic HSC, whereas the expression of the complement-activating protease P100 in both cell types showed little difference and that of the extracellular matrix component fibulin 2 was similar. The expression of smooth muscle ␣-actin protein in cultured peribiliary myofibroblasts was stimulated by PDGF-BB and inhibited by STI571, a PDGF receptor tyrosine kinase inhibitor, whereas in bile duct-ligated rats, the administration of STI571 caused a significant decrease in peribiliary smooth muscle ␣-actin immunoreactivity, and to a lesser extent, a decrease in peribiliary fibrosis. These results indicate that peribiliary cells distinct from HSC undergo a PDGF-mediated conversion into myofibroblasts expressing IL-6 at lower levels than myofibroblastic HSC and contribute to the initial formation of biliary-type liver fibrosis. (Lab Invest 2003, 83:163-173).

To study the prevalence of the Val617Phe JAK2 mutation in familial cases of myeloproliferative disorder (MPD) and its possible implication as a predisposing genetic factor, we analyzed 72 families including 174 patients (

To validate Northern blots results, one usually rehybridize the filters with a probe corresponding to a basic cellular function (e.g. beta actin, GAPDH). However, expression of these genes varies with proliferation and differentiation. 28S rRNA, being the major component of cellular RNA, is a better candidate for normalizing Northern blots prepared with total RNA. To obtain quantitative hybridization results one needs to be in probe excess, which for 28S rRNA can only be practically achieved with an oligonucleotide probe. We selected the sequence 4011-4036 of the human 28S rRNA (Gonzalez et al. P.NA.S. 82, 7666-7670, 1985) as a potentially single stranded domain which is well conserved between species (one mismatch with the mouse and rat sequence). The complementary oligonucleotide 5' AACGATCAGAGTAGTGGTATTTCA CC 3' was synthetized with a yield of 1.2 mg, equivalent to 240 mg of full length 28S molecules. Figure A presents the results of a blot containing from 1 to 6 ug per lane of K 562 total RNA and hybridized successively with the 28S oligonucleotide and a beta actin probe. Both probes give a signal proportional to the amount of RNA (figure B). Consequently, the "normalized" actin signal (Le. actin/28S) varies only by 20% when the amount of RNA varies from 2 to 6 ug. Under our experimental conditions saturation of the 28S signal was observed with 10 jig of total RNA loaded in a 7 mm well. Importantly, the correlation between the 28S and the beta actin signal is not dependent upon the order of hybridization even though the amount of 28S detectable is more severely reduced by dehybridization than the amount of beta actin. Figure C illustrates the usefullness of a 28S probe when analysing distinct samples. While the beta actin signals observed with 4 ,jig of mouse liver, kidney and bone marrow total RNA were 1, 33 and 13.6 respectively, me 28S signals were 1, O and 1.15 for the same samples. METHODS : Nylon filters were prepared as described (Dautry et al. J.B.0,263, 17615-17620, 1988). 100 ngof the 28S oligo were labelled with T4 kinase and X 32 P-ATP to a specific activity of 2-10 X 10' cpm/ug. For hybridization, the probe was diluted with unlabelled oligo to achieve 10 times the amount of target sequence present on the filter. Hybridization was performed overnight at 42° in 4X SPE, 0.1% Na pyrophosphate, 02% SDS, 500 ug/ml heparin. Filters were rinced once and washed for 30* at 37° in 2X SPE, 0.1% Na pyrophosphate, 0.1% SDS. Quantification was achieved by scintillation counting of the corresponding areas of the filters. We routinely reuse several times the hybridization mix, being careful to monitor the remaining amount of 28S oligonucleotide. 7115Downloaded from https://academic.oup.com/nar/article-abstract/17/17/7115/2377098 by guest on 07 June 2019