Necrotizing hepatopancreatitis (NHP) is a severe bacterial disease that was previously identified solely in cultured Penaeus vannamei, the Pacific white shrimp, from Texas (USA). In January 1993, a disease with similar clinical and histopathologic features to NHP was diagnosed in P vannamei cultured in Peru. Oligonucleotide primers derived from variable regions V5, V8 and V9 of the 16s ribosomal RNA gene sequence enabled polymerase chain reaction (PCR) confirmation of the diagnosis of NHP in both Texan and Peruvian shrimp. The PCR amplification products from the clinical specimens were compared to the PCR amplification product obtained from a sucrose-gradient purified sample of bacteria that was previously used to reproduce NHP. In this study, fingerprinting by restriction fragment length polymorphism (RFLP) analysis of the PCR products was used to compare the isolates. Results indicate that hepatopancreatic lesions are caused by the same bacterium in both Texas and Peru. Negative results were obtained from uninfected shrimp and shrimp infected with Vibr~o spp., as well as DNA extracted from Brucella abortus, Ehrlichia risticji, SalmoneUa enteritidis, Agrobacterium tumefaciens and Streptococcus crlae.
Nucleotide sequence polymorphism due to a variation in the number of GT dinucleotide repeats was found in the 3’ untranslated region (nucleotide positions 1781–1804) of the bovine natural resistance‐associated macrophage protein (NRAMP1) gene. The total variation in the number of GT repeats resulted not only from changes in the number of GT repeats but also from variation in the number of 5’ adjacent Gs. Two types of event may explain the polymorphism recently termed ‘allelic homoplasy’ (Grimaldi & Crouau‐Roy, 1997). Besides addition and/or deletion of GT repeats, a T vs. G transversion at position 1782 at the 5’ end of the GT repeat array generated variability in 3’ UTR of the bovine NRAMP1 gene. Another substitution site (G→A), interrupting the GT repeat array at position 1805, previously reported in cattle and not found in related species, was not found to show within‐species polymorphism. Although the functional significance of the polymorphism reported remains unknown, its detection allows investigation of associations with resistance and/or susceptibility to important intracellular pathogens in cattle. Microsatellites, short repetitive sequences of usually two to six nucleotides, represent an important part of DNA in multicellular organisms (Ramel, 1997). Due to their extensive polymorphism, they are used in gene mapping, parentage testing, and evolutionary biology. Despite their widespread use, mechanisms generating the variability of microsatellites still have not been completely clarified. The major mechanism leading to microsatellite allelic diversity is addition or deletion of small numbers of repeats, mostly of a single repeat unit, due to strand slippage during DNA replication (Goldstein & Pollock, 1997). Detailed analyses of sequence variability at individual microsatellite loci may reveal complex mutation patterns (Macaubas et al., 1997). In mice, the locus Bcg/Lsh/Ity, controlling natural resistance to intracellular parasites, and its candidate gene, NRAMP1 (for natural resistance‐associated macrophage protein), have been identified. Homologous sequences in humans and other species were detected subsequently (Vidal et al., 1993; Skamene et al., 1998). Here, we describe a complex pattern of microsatellite polymorphism revealed during our search for polymorphisms within the bovine homologue of the mouse NRAMP1 (bovine NRAMP1) gene (Feng et al., 1996). Fifty ng of genomic DNA, isolated from blood of Czech Red Pied and Czech Black Pied cattle, was amplified using primers specific for the 3’ untranslated region (nucleotide positions 1745–1955). The forward primer NRAMPF (5’‐GTGGAATGAGTGGGCACAGT‐3’) and the reverse primer NRAMPR (5’‐CTCTCCGTCTTGCTGTGCAT‐3’) were designed based on the sequence published previously (Feng et al., 1996). PCR was performed in a volume of 25 μL, containing 1 × reaction buffer (50 mM KCl, 10 mM Tris‐HCl, pH 9.0, and 0.1% Triton X‐100), 0.2 mM of each deoxyribonucleotide, 1.0 mM MgCl2, 0.5 μM of each of the primers, and 1 U Taq DNA polymerase (Promega, Madison, USA). After an i...
scite is a Brooklyn-based organization that helps researchers better discover and understand research articles through Smart Citations–citations that display the context of the citation and describe whether the article provides supporting or contrasting evidence. scite is used by students and researchers from around the world and is funded in part by the National Science Foundation and the National Institute on Drug Abuse of the National Institutes of Health.
hi@scite.ai
10624 S. Eastern Ave., Ste. A-614
Henderson, NV 89052, USA
Copyright © 2024 scite LLC. All rights reserved.
Made with 💙 for researchers
Part of the Research Solutions Family.