Non syndromic orofacial clefts specifically non-syndromic cleft lip/palate are one of the most common craniofacial malformation among birth defects in human having multifactorial etiology with an incidence of 1:700/1000. On the basis of association with other congenital malformations or their presence as isolated anomaly, OFC can be classified as syndromic (30%) and nonsyndromic (70%) respectively. The major cause of disease demonstrates complex interplay between genetic and environmental factors. The pathogenic mechanism of underlying factors have been provided by different genetic studies on large-scale with significant recent advances in genotyping technologies usually based on linkage or genome wide association studies (GWAS). On the basis of recent studies, new tools to identify causative genes involved in NSCL/P reported approximately more than 30 genetic risk loci that are responsible for pathogenesis of facial deformation. Despite these findings, it is still uncertain that how much of variance in NSCL/P predisposing factors can be explain by identified risk loci, as they all together accounts for only 20%–25% of NSCL/P heritability. So there is need of further findings about the problem of rare low frequency coding variants and other missing responsive factors or genetic modifiers. This review will described those potential genes and loci reported in different studies whose involvement in pathogenesis of nonsyndromic OFC has wide scientific evidence.

No abstract

Progressive familial intrahepatic cholestasis type 3 (PFIC3) is a hepatic disorder occurring predominantly in childhood and is difficult to diagnose. PFIC3, being a rare autosomal recessive disease, is caused by genetic mutations in both alleles of ABCB4, resulting in the disruption of the bile secretory pathway. The identification of pathogenic effects resulting from different mutations in ABCB4 is the key to revealing the internal cause of disease. These mutations cause truncation, instability, misfolding, and impaired trafficking of the MDR3 protein. Here, we reported a girl, with a history of intrahepatic cholestasis and progressive liver cirrhosis, with an elevated gamma-glutamyltransferase level. Genetic screening via whole exome sequencing found a novel homozygous missense mutation ABCB4:c.1195G>C:p.V399L, and the patient was diagnosed with PFIC3. Various computational tools predicted the variant to be deleterious and evolutionary conserved. For functional characterization studies, plasmids, encoding ABCB4 wild-type and selected established mutant constructs, were expressed in human embryonic kidney (HEK-293T) and hepatocellular carcinoma (HepG2) cells. In vitro expression analysis observed a reduced expression of mutant protein compared to wild-type protein. We found that ABCB4 wild type was localized at the apical canalicular membrane, while mutant p.V399L showed intracellular retention. Intracellular mistrafficking proteins usually undergo proteasomal or lysosomal degradation. We found that after treatment with proteasomal inhibitor MG132 and lysosomal inhibitor bafilomycin A1, MDR3 expression of V399L was significantly increased. A decrease in MDR3 expression of mutant V399L protein may be a result of proteasomal or lysosomal degradation. Pharmacological modulator cyclosporin A and intracellular low temperature (30°C) treatment significantly rescued both the folding defect and the active maturation of the mutant protein. Our study identified a novel pathogenic mutation which expanded the mutational spectrum of the ABCB4 gene and may contribute to understanding the molecular basis of PFIC3. Therefore, genetic screening plays a conclusive role in the diagnosis of rare heterogenic disorders like PFIC3.

A comprehensive summary of recent knowledge in syndactyly (SD) is important for understanding the genetic etiology of SD and disease management. Thus, this review article provides background information on SD, as well as insights into phenotypic and genetic heterogeneity, newly identified gene mutations in various SD types, the role of HOXD13 in limb deformities, and recently introduced modern surgical techniques for SD. This article also proposes a procedure for genetic analysis to obtain a clearer genotype–phenotype correlation for SD in the future. We briefly describe the classification of non-syndromic SD based on variable phenotypes to explain different phenotypic features and mutations in the various genes responsible for the pathogenesis of different types of SD. We describe how different types of mutation in HOXD13 cause various types of SD, and how a mutation in HOXD13 could affect its interaction with other genes, which may be one of the reasons behind the differential phenotypes and incomplete penetrance. Furthermore, we also discuss some recently introduced modern surgical techniques, such as free skin grafting, improved flap techniques, and dermal fat grafting in combination with the Z-method incision, which have been successfully practiced clinically with no post-operative complications.

BackgroundSynpolydactyly type 1 (SPD1), also known as syndactyly type II, is an autosomal dominant limb deformity generally results in webbing of 3rd and 4th fingers, duplication of 4th or 5th toes. It is most commonly caused by mutation in HOXD13 gene. In this study, a five-generation Chinese family affected with SPD1 disease were collected. We tried to identify the pathogenic variations associated with SPD1 involved in the family.MethodsWe used the whole genome sequencing (WGS) to identify the pathogenic variant in this family which was later confirmed by PCR-Sanger sequencing. The genetic variation were evaluated with the frequencies in the 1000 Genome Project and Exome Aggregation Consortium (ExAC) dataset. The significance of variants were assessed using different mutation predictor softwares like Mutation Taster, PROVEAN and SIFT. The classification of variants was assessed according to American College of Medical Genetics and Genomics (ACMG) guidelines.ResultsOur results showed the mutation of 24-base pair duplication (c.183_206dupAGCGGCGGCTGCGGCGGCGGCGGC) in exon one of HOXD13 in heterozygous form which was predicted to result in eight extra alanine (A) residues in N-terminal domain of HOXD13 protein. The mutation was detected in all affected members of the family.ConclusionBased on our mutation analysis of variant c.183_206dupAGCGGCGGCTGCGGCGGCGGCGGC in HOXD13 and its cosegregation in all affected family members, we found this variant as likely pathogenic to this SPD1 family. Our study highlights variable expressivity of HOXD13 mutation. Our results also widen the spectrum of HOXD13 mutation responsible for SPD1.