Hearing loss is highly prevalent with a worldwide incidence of 1-2 per 1000 newborns. Several previous studies have demonstrated that mutations of connexin 26 (Cx26 or GJB2) are responsible for most cases of the recessive non-syndromic sensorineural hearing loss (NSSHL). Certain mutations have been described frequently among various populations, which include 35delG, 167delT, and 235delC. Recently, a missense mutation, V37I, was reported as a pathogenic change in East Asian affected individuals. To identify genetic variants associated with NSSHL in Thai population, we performed mutation analysis of Cx26 in 166 unrelated probands with NSSHL and 205 controls. We identified seven novel genetic variants in Cx26. We also identified a high prevalence of the V37I mutation among both affected probands (11.1%) and control subjects (8.5%), which suggests that the pathologic role of V37I may be modified by other genes. Our data support previous studies that show heterogeneity in the frequencies and types of mutations in Cx26 within populations and among ethnicities and that before clinical significance and causality can be attributed to a genetic variant, functional characterization is necessary.
Introduction The long-term effects of long-acting testosterone undecanoate (TU) and androgen receptor CAG repeat lengths in Thai men with late-onset hypogonadism (LOH) have not been reported. Aim To analyze the 8-year follow-up effects of intramuscular TU therapy on metabolic parameters, urinary symptoms, bone mineral density, and sexual function and investigate CAG repeat lengths in men with LOH. Methods We reviewed the medical records of 428 men with LOH who had been treated with TU and 5 patients were diagnosed with prostate cancer during TU therapy. There were 120 patients (mean age = 65.6 ± 8.9 years) who had 5 to 8 years of continuous TU supplementation and sufficiently completed records for analysis. Genomic DNA was extracted from peripheral blood and the CAG repeat region was amplified by polymerase chain reaction. Fragment analysis, sequencing, electropherography, and chromatography were performed. Main Outcome Measures The main outcome measure was dynamic parameter changes during testosterone supplementation. Results TU did not improve all obesity parameters. A statistically significant decrease was found in waist circumference, percentage of body fat, glycated hemoglobin, cholesterol, low-density lipoprotein, and International Prostate Symptom Score (P < .05). TU did not produce differences in body mass index, high-density lipoprotein, triglyceride, or the Aging Male Symptoms score from baseline. However, a statistically significant increase was found in the level of testosterone, prostate-specific antigen, hematocrit, International Index of Erectile Function score, and vertebral and femoral bone mineral density (P < .05). No major adverse cardiovascular events or prostate cancer occurred during this study. The CAG repeat length was 14 to 28 and the median CAG length was 22. There was no association between CAG repeat length and any of the anthropometric measurements. Conclusion Long-term TU treatment in men with LOH for up to 8 years appears to be safe, tolerable, and effective in correcting obesity parameters.
Waardenburg syndrome (WS) is a prevalent hearing loss syndrome, concomitant with focal skin pigmentation abnormalities, blue iris, and other abnormalities of neural crest-derived cells, including Hirschsprung’s disease. WS is clinically and genetically heterogeneous and it is classified into four major types WS type I, II, III, and IV (WS1, WS2, WS3, and WS4). WS1 and WS3 have the presence of dystopia canthorum, while WS3 also has upper limb anomalies. WS2 and WS4 do not have the dystopia canthorum, but the presence of Hirschsprung’s disease indicates WS4. There is a more severe subtype of WS4 with peripheral nerve and/or central nervous system involvement, namely peripheral demyelinating neuropathy, central dysmyelinating leukodystrophy, WS, and Hirschsprung’s disease or PCW/PCWH. We characterized the genetic defects underlying WS2, WS4, and the WS4-PCW/PCWH) using Sanger and whole-exome sequencing and cytogenomic microarray in seven patients from six unrelated families, including two with WS2 and five with WS4. We also performed multiple functional studies and analyzed genotype–phenotype correlations. The cohort included a relatively high frequency (80%) of individuals with neurological variants of WS4. Six novel SOX10 mutations were identified, including c.89C > A (p.Ser30∗), c.207_8 delCG (p.Cys71Hisfs∗62), c.479T > C (p.Leu160Pro), c.1379 delA (p.Tyr460Leufs∗42), c.425G > C (p.Trp142Ser), and a 20-nucleotide insertion, c.1155_1174dupGCCCCACTATGGCTCAGCCT (p.Phe392Cysfs∗117). All pathogenic variants were de novo. The results of reporter assays, western blotting, immunofluorescence, and molecular modeling supported the deleterious effects of the identified mutations and their correlations with phenotypic severity. The prediction of genotype–phenotype correlation and functional pathology, and dominant negative effect vs. haploinsufficiency in SOX10-related WS were influenced not only by site (first two vs. last coding exons) and type of mutation (missense vs. truncation/frameshift), but also by the protein expression level, molecular weight, and amino acid content of the altered protein. This in vitro analysis of SOX10 mutations thus provides a deeper understanding of the mechanisms resulting in specific WS subtypes and allows better prediction of the phenotypic manifestations, though it may not be always applicable to in vivo findings without further investigations.
scite is a Brooklyn-based organization that helps researchers better discover and understand research articles through Smart Citations–citations that display the context of the citation and describe whether the article provides supporting or contrasting evidence. scite is used by students and researchers from around the world and is funded in part by the National Science Foundation and the National Institute on Drug Abuse of the National Institutes of Health.
hi@scite.ai
10624 S. Eastern Ave., Ste. A-614
Henderson, NV 89052, USA
Copyright © 2024 scite LLC. All rights reserved.
Made with 💙 for researchers
Part of the Research Solutions Family.