Soybean rust caused by Phakopsora pachyrhizi is one of the most serious economic threats to soybean production in South America. A previous study using South American P. pachyrhizi populations collected between 2007/2008 and 2009/2010 revealed the pathogenic diversity in Argentinean, Brazilian, and Paraguayan rust populations. Because such pathogenic diversity has been a major constraint to the breeding program for soybean rust resistance, pathogen populations were continuously monitored throughout the 2010/2011 to 2014/2015 seasons using the same method of evaluating pathogenicity as used in the previous study. None of the 83 P. pachyrhizi samples collected from the three countries from 2010/2011 to 2014/2015 yielded identical pathogenicity patterns in the 16 differentials, thus demonstrating the pathogenic diversity of more recent South American rust populations. Cluster analysis using a total of 145 rust populations from 2007 to 2015 demonstrated that the Argentinean, Brazilian, and Paraguayan populations were not assigned to three distinct country-based groups. The analysis indicated that a majority of South American populations differed in pathogenicity compared with Japanese rust races. The rates of resistance to the rust populations varied among the 13 differentials carrying Rpp genes; the most effective resistance gene was Rpp1-b followed by Rpp5, and the least effective was Rpp1.
Wheat yellow (stripe) rust caused by Puccinia striiformis Westend. f. sp. tritici Eriks. (Pst) is an important disease worldwide (Chen 2005; Afzal et al., 2007; Hovmøller et al. 2011). In Latin America, the disease has been reported in Argentina, Bolivia, Chile, Colombia, Ecuador, Peru, Brazil, and Uruguay (van Beuningen and Kohli, 1986; German et al., 2007). The disease was observed for the first time in Paraguay at Capitán Miranda (Itapúa) (27°12’07.5888’’S, 55°47’20.3640’’W) in an environment with average minimum temperature below 10°C in July 2021 (coldest month). Symptoms were yellow rust pustules distributed linearly on the leaves of adult host plants (Fig. 1). Oval-shaped uredinia contained unicellular, yellow to orange, spherical urediniospores (28, 82 × 26, 83 μm), within the range reported by Rioux et al. (2015). Black telia produced yellow to orange teliospores (64, 12 × 15, 46 μm), which were within the range reported by Chen et al. (2014). All susceptible wheat cultivars had up to 100% disease severity. Ten- day-old seedlings of the susceptible cultivars were inoculated in a greenhouse using urediniospores collected from the field. Two weeks after inoculation, extensive sporulation was observed on the seedlings. For pathogen identification, DNA was extracted from wheat leaf segments containing urediniospores using the PureLink® Plant Total DNA Purification Kit (Invitrogen). PCR and sequencing were carried out by Macrogen (Korea), using the following species-specific primers: PSF (5`-GGATGTTGAGTGCTGCTGTAA-3`) / PSR (5`-TTGAGGTCTTAAGGTTAAAATTG-3`), which amplifies an internal transcribed spacer (ITS) region (Zhao et al. 2007); LidPs9 (TCGGTAAAACTGCACCAATACCT) / LidPs10 (TCCCAACAGTCCCCTTCTGT), which amplifies a fragment of the RNA polymerase II gene encoding the second largest subunit (rpb2); and LidPs11 (TTACGACATCTGCTTCCGCA) / LisPs12 (TGCGATGTCAACTCTGGGAC) and LidPs13 (TACGACATCTGCTTCCGCAC) / LidPs14 (GATTGCCCGGTATTGTTGGC), both pairs amplifying fragments of the β-tubulin 1 gene (tub1) (Kuzdraliński et al. 2017). The sequences obtained were OM631935, OM638432, OM718000, and OM718001 and were aligned using the GenBank BLAST tool (https://blast.ncbi.nlm.nih.gov/Blast.cgi), obtaining a 100% match with the following sequences: KC677574.1, KY411522.1, KY411533.1, and KY411542.1, respectively. Yellow-rust-infected leaf samples were collected from a field trial and sent to the Global Rust Reference Center (GRRC), Denmark. Simple sequence repeat (SSR) genotyping of samples from two different cultivars exhibited the genetic lineage PstS13 (www.wheatrust.org), which had previously been detected in South America (Carmona et al., 2019), thereby confirming the first report of wheat yellow rust in Paraguay. Considering that the Paraguayan wheat germplasm is highly susceptible to yellow rust, further studies are required to monitor potential spread and establishment of yellow rust in Paraguay and to explore potential sources of resistance to prevent future epidemics.
La roya de la hoja de trigo (RH), causada por Puccinia triticina Ericks, es una de las enfermedades del cultivo más prevalentes en Uruguay y otros países del Cono Sur. En epidemias severas se han estimado pérdidas de rendimiento de más de 50 % y pueden ser necesarias dos o más aplicaciones de fungicidas para controlar la enfermedad en cultivares susceptibles. Los estudios de la variabilidad del patógeno son importantes para determinar su rango de virulencia, para inferir el mecanismo de su variación, determinar el origen y dispersión de los patotipos y confirmar la presencia de nuevas razas inferidas por el cambio de comportamiento del hospedero. El objetivo de esta investigación fue estudiar la diversidad en la población de P. triticina en Uruguay durante 2011 y 2012. Se estudiaron un total de 363 muestras de RH recolectadas en diferentes momentos de distintos cultivares y localidades de la región del cultivo. La prevalencia de las 22 razas identificadas (de mayor a menor frecuencia MFP; TDT-10,20; MDP; MDT-10,20; TFT-10,20; MFP-20; MFP-10,20; MDP-20; DBB-10,20; MKD-10; TPR-20,39; MFT-10,20; MDP-10,20; MDR-10,20; MFT; MDT; MFP-10; MHJ-10; MJD-10; TMD-10,20; MCP; MFR-10,20), se relacionó a su virulencia sobre los cultivares utilizados por los agricultores. La presencia o frecuencia de las razas varió entre años, zonas y momento de recolección. Se reportan por primera vez las razas DBB-10,20, MHJ-10, MJD-10, MKD-10, TMD-10,20 y TPR-20,30, no previamente detectadas en Uruguay. Este estudio permitió confirmar que la población del patógeno presente en Uruguay es diversa y continúa evolucionando.
The aim of this work was to identify genetic resistance to charcoal rot (Macrophomina phaseolina) in soybean germplasm from the National Breeding Program of the Instituto Paraguayo de Tecnología Agraria (Paraguayan Institute of Agricultural Technology). During two seasons, 51 commercial and experimental lines from the local breeding program were field evaluated in Itapúa-Paraguay. The lines were planted in single rows previously infested, using a completely randomized block design with four repetitions. The charcoal rot severity was evaluated in the stems and roots at the physiological maturity stage. On a Root and Stem Severity index scale of 1-5, the median severity for the 34 early maturity genotypes was 1.5 and 1 in 2017/2018 and 2018/2019, respectively. Nine genotypes (AG-6525 xi, SP14041, SP14222, SP14583, SP15013, SP15133, SP15218, SP16020, and SPB-14146) were rated as resistant (1) in both evaluations. The median severity for the 15 semi-early genotypes was 2 and 1 in 2017/2018 and 2018/2019, respectively. This study allowed us to identify previously unreported sources of resistance to charcoal rot in maturity group IV, V and VI. We believe that germplasm screening under field conditions is a viable alternative to identify breeding lines which are less sensitive to charcoal rot.
Leaf rust (LR) of bread wheat (Triticum aestvium L.), caused by the fungus Puccinia triticina Eriks, is one of the most important diseases in Paraguay, the Southern Cone and worldwide. The economic importance of the disease is clear considering that two or more fungicide applications are necessary to control it in susceptible cultivars. The best strategy for the management of this disease is through genetic resistance. This research was conducted in Uruguay aiming to postulate the LR resistance genes present in 102 lines and wheat cultivars from Paraguay, and to study their field resistance. The presence of 18 major resistance genes expressed at the seedling stage (Lr1, Lr2, Lr3a, Lr3bg, Lr3ka, Lr9, Lr10, Lr11, Lr16, Lr17, Lr23, Lr24, Lr26, Lr27+Lr31, Lr28, Lr30, Lr42) was postulated based on the reaction to different races of the pathogen. The adult plant resistance gene Lr34 was confirmed in 26% of the materials, based on the molecular marker csLV34. This study also allowed differentiating materials with field resistance that can be explained by the seedling resistance and those with adult plant resistance. Knowledge of the resistance genes present in the germplasm of breeding programs is of paramount importance to establish strategies in order to achieve effective and long-lasting resistance based mainly on the combination of race-non-specific minor genes.
scite is a Brooklyn-based organization that helps researchers better discover and understand research articles through Smart Citations–citations that display the context of the citation and describe whether the article provides supporting or contrasting evidence. scite is used by students and researchers from around the world and is funded in part by the National Science Foundation and the National Institute on Drug Abuse of the National Institutes of Health.
hi@scite.ai
10624 S. Eastern Ave., Ste. A-614
Henderson, NV 89052, USA
Copyright © 2024 scite LLC. All rights reserved.
Made with 💙 for researchers
Part of the Research Solutions Family.