The Dominican Republic has a significant area of the country cultivated with vegetables. In July 2013, in the provinces of Moca and La Vega, horticultural crops showed typical tospovirus symptoms (>30% incidence), including bronzing, chlorosis, necrosis, and ring spots on leaves and fruits. Samples were collected from potatoes (Solanum tuberosum), long beans (Vignaun guiculata), chili peppers (Capsicum frutescens), sweet peppers (C. annuum), and tomatoes (S. lycopersicum). Serological tests were clearly positive for infection by Tomato spotted wilt virus (TSWV) and/or related tospoviruses when tested with AgDia immunostrips. The viral RNA extracted from five plants per host was pooled to construct a cDNA library that was sequenced using an Illumina HiSeq 2000 platform. The paired-end reads were assembled using CLC Genomic Workbench version 6.0.3. The assembled contigs were submitted to BLASTx against a viral genome database. The results confirmed the presence of Tomato chlorotic spot virus (TCSV) and TSWV. Then, PCR tests were performed with primers pairs TSWV-LF 5′ CTGTTGTCTATTGAGGATTGTG 3′ AND TSWV-LR 5′ CAGAGAGCTTGTTAATGCAGGAC 3′ to amplify part of the TSWV L RNA, the pairs TCSV-SF 5′ AACTGGGAAAGCAGAAAACC 3′ and TCSV-SR 5′ CCTTACTCCGAACATTGCA 3′, and GRSV-SF 5′ CTGTCAGGAAAATCTTGACCTG 3′ and GRSV-SR 5′ CTTGACTCCAAACATCTCGT 3′ to detect part of the TCSV and Groundnut ringspot virus (GRSV) S segments. In the long bean and chili pepper samples from La Vega, only TCSV was detected (40% of the all samples) based on amplification of the expected size fragment with the S RNA specific primer pair. All the other samples were positive for TSWV and no GRSV was detected. The complete N gene of TCSV and TSWV were amplified using the primer pairs TCSV-NR2 5′ CACACTGAACTGAACTATAACACAC 3′ and TCSV-NF 5′ ACCTTGAATCATATCTCTCG 3′ and primers N-TSWV_FW 5′ TACGGATCCGATGTCTAAGGTTAAGCTCAC 3′ and N-TSWV_RV 5′ TTATCTCGAGTCAAGCAAGTTCTGCGAG 3′. The TCSV N protein sequences (KJ399303 and KJ399304) were 99% identical with the TCSV found in processing tomatoes in the Dominican Republic (1) and the United States (2). The TSWV N protein sequences (KJ399313, KJ399314 and KJ399315) shared 96 to 98% identity with the TSWV N sequences available. Dot blot hybridization tests (1) using DIG-labeled specific TCSV N gene probe confirmed TCSV infection in PCR-positive long bean and chili pepper samples, whereas no hybridization signal was detected for TSWV-infected tomatoes, potatoes, sweet peppers, or healthy samples. In addition, no reassortants were detected based on amplification of the expected size RNA fragments (3). These other amplicons (KJ399301, KJ399299, KJ399302, and KJ399300) showed 98% identity with the L and M segments of TCSV. Thrips collected from symptomatic plants were identified mainly as Frankliniella schultzei, consistent with the main thrips species transmitting TCSV. In the last two years, TCSV was reported in North and Central America and in the Caribbean Basin (1,2,4). These findings have an important epidemiological impact since TCSV represents a new threat to other horticultural crops affected by this tospovirus. References: (1) O. Batuman et al. Plant Dis. 98:286, 2014. (2) A. Londono et al. Trop. Plant Pathol. 37:333, 2012. (3) C. G. Webster et al. Virology 413:216, 2011. (4) C. G. Webster et al. Plant Health Progress. Online publication. doi:10.1094/PHP-2013-0812-01-BR, 2013.

No abstract

The Tomato chlorotic spot virus (TCSV) was first reported in the 1980s, having its occurrence limited to Brazil and Argentina. Due to an apparent mild severity in the past, molecular studies concerning TCSV were neglected. However, TCSV has disseminated over the USA and Caribbean countries. In Dominican Republic TCSV has been recently reported on important cultivated crops such as pepper and beans. In this work, we provide the first complete genome of a TCSV isolate from symptomatic plants in Dominican Republic, which was obtained by high-throughput sequencing. In addition, three dsRNA viruses from different virus families were identified coinfecting these plants Bell pepper endornavirus (BPEV), Southern tomato virus (STV) and Pepper cryptic virus 2 (PCV-2). Phylogenetic analysis showed that the Dominican Republic TCSV isolate has a close relationship with other TCSV isolates and a reassortant isolate between TCSV and Groundnut ringspot virus (GRSV), all found in USA. BPEV, STV and PCV-2 isolates from Dominican Republic were close related to corresponding American isolates. The possible biological implications of these virus-mixed infections are discussed.

Orthotospoviruses (genus Orthotospovirus, family Tospoviridae) are amongst the most devastating plant viruses worldwide, causing severe damage to many economically important vegetable crops, such as tomato and sweet pepper. Monitoring virus populations is an important step for estimating virus damage and epidemiology, and gaining insights into the adaptation processes undergone by orthotospoviruses. Here, we studied the orthotospovirus populations infecting vegetable crops in Brazil and the Dominican Republic, including species diversity, genome comparison and phylogenetic analyses. Comparisons of virus populations showed that in Brazil, which is considered a center of orthotospovirus diversity, groundnut rinspot virus (GRSV) is prevalent, infecting 41% of the plants, whereas tomato spotted wilt virus (TSWV) and tomato chlorotic spot virus (TCSV) were present in 4% and 9% of the samples, respectively. In the Dominican Republic, which can be considered an environment with low orthotospovirus diversity, 55% of the samples were infected with TSWV, 11% showed TCSV infection and no GRSV was detected. The occurrence of mixed infection was low in Brazil, at only 5%, but no mixed infection was detected in the Dominican Republic. The low rates of mixed infections may prevent the emergence of genomes resulting from reassortment. Indeed, no reassortant viruses were detected in either country, except for TCSV, recently proposed as representing a reassortant orthotospovirus species.

No abstract