Source/Description: Cosmid clone cDBH14 was isolated by screening a human cosmid library (1) with an 800bp BamHI/EcoRI fragment derived from a DBH cDNA clone (2). A 1kb PstI subclone of cosmid cDBH14 was shown to hybridize to the probe (GT)15, and was sequenced outwards from the repeat using the primers (GT)7-AIC/T-N and (AC)7-C/G/T-N (3). In addition, a phage clone, XD8. 1, was selected from a human genomic library by PCR and hybridization to a DBH cDNA probe (2). A 1kb HindIm subclone of phage XD8. 1 was shown to hybridize to poly(CA) and was fully sequenced. The phage sequence has been submitted to the EMBL data library with the accession number X63418. Primer Sequences: GCAGTCACGCATCCTTATGG (GT strand). CAGCTCTGGGCTCATGCTC (AC strand). Frequency: Estimated from 224 chromosomes from unrelated individuals. PIC = 0.47, observed heterozygosity = 0.51. Allele Fl (180bp) 0.013 Allele F2 (178bp) 0.093 Allele F3 (176bp) 0.265 Allele F4 (174bp) 0.625 Allele F5 (172bp) 0.004 Chromosomal Localization: DBH has been localized to 9q34 by linkage analysis (4) and in situ hybridization (5). Mendelian Inheritance: Consistent with Mendelian inheritance in two 3-generation and two 2-generation families. PCR Conditions/Comments: Amplification was carried out using the following conditions: 30 cycles of 1 minute at 940C, 45 seconds at 59°C and 25 seconds at 70°C. Alleles were separated by electrophoresis on 8% polyacrylamide. The (GT) strand corresponds to the + strand of the DBH gene.
The tumor suppressor TP53 is mutated in approximately 70% of Li-Fraumeni syndrome (LFS) families; however, other genes may lead to the predisposition to tumors in other families. We developed a mouse model to search for other tumor suppressors that may be involved in the syndrome. Inbred CE/J mice, which succumb to multiple types of tumors similar to those found in LFS, were crossed with the Trp53-null 129-Trp53tm1Tyj mouse. We monitored the tumor onset and type and found a significant earlier tumor onset in the CE/J:129-Trp53tm1Tyj mice compared with 129-Trp53tm1Tyj mice with a Trp53-null allele. Additionally, in CE/J:129-Trp53tm1Tyj-Trp53+/- mice, the tumors metastasize, which does not occur in other strains of mice. Using simple-sequence length polymorphism analysis for loss of heterozygosity in tumors, we identified a putative tumor suppressor locus within 1 cM on mouse chromosome 11, which encompasses 12 mapped genes.
scite is a Brooklyn-based organization that helps researchers better discover and understand research articles through Smart Citations–citations that display the context of the citation and describe whether the article provides supporting or contrasting evidence. scite is used by students and researchers from around the world and is funded in part by the National Science Foundation and the National Institute on Drug Abuse of the National Institutes of Health.
hi@scite.ai
10624 S. Eastern Ave., Ste. A-614
Henderson, NV 89052, USA
Copyright © 2024 scite LLC. All rights reserved.
Made with 💙 for researchers
Part of the Research Solutions Family.