Methods for the site-specific incorporation of extra components into nucleic acids can be powerful tools for creating DNA and RNA molecules with increased functionality. We present an unnatural base pair system in which DNA containing an unnatural base pair can be amplified and function as a template for the site-specific incorporation of base analog substrates into RNA via transcription. The unnatural base pair is formed by specific hydrophobic shape complementation between the bases, but lacks hydrogen bonding interactions. In replication, this unnatural base pair exhibits high selectivity in combination with the usual triphosphates and modified triphosphates, gamma-amidotriphosphates, as substrates of 3' to 5' exonuclease-proficient DNA polymerases, allowing PCR amplification. In transcription, the unnatural base pair complementarity mediates the incorporation of these base substrates and their analogs, such as a biotinylated substrate, into RNA by T7 RNA polymerase (RNAP). With this system, functional components can be site-specifically incorporated into a large RNA molecule.

Toward the expansion of the genetic alphabet, we present an unnatural base pair system for efficient PCR amplification, enabling the site-specific incorporation of extra functional components into DNA. This system can be applied to conventional PCR protocols employing DNA templates containing unnatural bases, natural and unnatural base triphosphates, and a 3′→5′ exonuclease-proficient DNA polymerase. For highly faithful and efficient PCR amplification involving the unnatural base pairing, we identified the natural-base sequences surrounding the unnatural bases in DNA templates by an in vitro selection technique, using a DNA library containing the unnatural base. The system facilitates the site-specific incorporation of a variety of modified unnatural bases, linked with functional groups of interest, into amplified DNA. DNA fragments (0.15 amol) containing the unnatural base pair can be amplified 107-fold by 30 cycles of PCR, with <1% total mutation rate of the unnatural base pair site. Using the system, we demonstrated efficient PCR amplification and functionalization of DNA fragments for the extremely sensitive detection of zeptomol-scale target DNA molecules from mixtures with excess amounts (pmol scale) of foreign DNA species. This unnatural base pair system will be applicable to a wide range of DNA/RNA-based technologies.

Lignin biosynthesis is an essential physiological activity of vascular plants if they are to survive under various environmental stresses on land. The biosynthesis of lignin proceeds in the cell wall by polymerization of precursors; the initial step of lignin polymerization is the transportation of lignin monomers from the cytosol to the cell wall, which is critical for lignin formation. There has been much debate on the transported form of the lignin precursor, either as free monolignols or their glucosides. In this study, we performed biochemical analyses to characterize the membrane transport mechanism of lignin precursors using angiosperms, hybrid poplar (Populus sieboldii × Populus grandidentata) and poplar (Populus sieboldii), as well gymnosperms, Japanese cypress (Chamaecyparis obtusa) and pine (Pinus densiflora). Membrane vesicles prepared from differentiating xylem tissues showed clear ATP-dependent transport activity of coniferin, whereas less than 4% of the coniferin transport activity was seen for coniferyl alcohol. Bafilomycin A1 and proton gradient erasers markedly inhibited coniferin transport in hybrid poplar membrane vesicles; in contrast, vanadate had no effect. Cis-inhibition experiments suggested that this transport activity was specific for coniferin. Membrane fractionation of hybrid poplar microsomes demonstrated that transport activity was localized to the tonoplast- and endomembrane-rich fraction. Differentiating xylem of Japanese cypress exhibited almost identical transport properties, suggesting the involvement of a common endomembrane-associated proton/coniferin antiport mechanism in the lignifying tissues of woody plants, both angiosperms and gymnosperms.

Glycoside hydrolase family 55 consists of ␤-1,3-glucanases mainly from filamentous fungi. A ␤-1,3-glucanase (Lam55A) from the Basidiomycete Phanerochaete chrysosporium hydrolyzes ␤-1,3-glucans in the exo-mode with inversion of anomeric configuration and produces gentiobiose in addition to glucose from ␤-1,3/1,6-glucans. Here we report the crystal structure of Lam55A, establishing the three-dimensional structure of a member of glycoside hydrolase 55 for the first time. Lam55A has two ␤-helical domains in a single polypeptide chain. These two domains are separated by a long linker region but are positioned side by side, and the overall structure resembles a rib cage. In the complex, a gluconolactone molecule is bound at the bottom of a pocket between the two ␤-helical domains. Based on the position of the gluconolactone molecule, Glu-633 appears to be the catalytic acid, whereas the catalytic base residue could not be identified. The substrate binding pocket appears to be able to accept a gentiobiose unit near the cleavage site, and a long cleft runs from the pocket, in accordance with the activity of this enzyme toward various ␤-1,3-glucan oligosaccharides. In conclusion, we provide important features of the substrate-binding site at the interface of the two ␤-helical domains, demonstrating an unexpected variety of carbohydrate binding modes.Many fungi produce ␤-1,3-glucans as the main components of the cell wall. The primary role of fungal ␤-1,3-glucans is structural; that is, to maintain cell wall rigidity and, thus, to protect the cell. The cell wall ␤-1,3-glucans are also suggested to be degraded for nutritional purposes after exhaustion of external nutrition (1). ␤-1,3-Glucans on the cell surface are thought to be involved in morphogenetic changes, i.e. aggregation and mycelial strand formation (2). Moreover, the hyphal sheath of pathogenic fungi contains extracellular ␤-1,3-glucans, which play an active role in wood cell wall degradation (3). Fungal ␤-1,3-glucans often contain some branches with ␤-1,6 glycosidic linkages, and these molecules are called ␤-1,3/1,6-glucans. The pattern of branching in ␤-1,3/1,6-glucans, e.g. linkage ratio and branch length, varies depending on fungal species, localization in the cell wall, and the growth phase of the cells.Fungi are prominent producers of ␤-1,3-glucanases, possibly due to the wide availability of the substrate in their cell wall (4). ␤-1,3-Glucanases are often termed laminarinases, as one of the most widely studied natural ␤-1,3-glucan-containing polymers is laminarin. Degradation of ␤-1,3-glucans by fungi often involves the cooperative action of multiple ␤-1,3-glucanases rather than a single enzyme. Although some fungal ␤-1,3-glucanases are constitutively produced, their expression levels are often controlled by culture conditions (5). Many ␤-1,3-glucanases have been characterized, and they exhibit a wide variety of substrate specificities and modes of actions (6). These facts suggest the involvement of ␤-1,3-glucanases in mobilization of cell wall ␤-glucans,...

Site-specific fluorescent labeling of RNA molecules was achieved by specific transcription using an unnatural base pair system. The unnatural base pairs between 2-amino-6-(2-thienyl)purine (s) and 2-oxo(1H)pyridine (y), and 2-amino-6-(2-thiazolyl)purine (v) and y function in transcription, and the substrates of y and 5-modified y bases can be site-specifically incorporated into RNA, opposite s or v in DNA templates, by T7 RNA polymerase. Ribonucleoside 5'-triphosphates of 5-fluorophore-linked y bases were chemically synthesized from the nucleoside of y. These fluorescent substrates were site-specifically incorporated into RNA by transcription mediated by the s-y and v-y pairs. By using this fluorescent labeling method, specific positions of Raf-binding and theophylline-binding RNA aptamers were fluorescently labeled, and the specific binding to their target molecules was detected by their fluorescent intensities. This site-specific labeling method using an unnatural base pair system will be useful for analyzing conformational changes of RNA molecules and for detecting interactions between RNA and its binding species.

The utility of various kinds of acid salts of azole derivatives as promoters for the condensation of a nucleoside phosphoramidite and a nucleoside is investigated. Among the salts, N-(phenyl)imidazolium triflate, N-(p-acetylphenyl)imidazolium triflate, N-(methyl)benzimidazolium triflate, benzimidazolium triflate, and N-(phenyl)imidazolium perchlorate have shown extremely high reactivity in a liquid phase. These reagents serve as powerful activators of deoxyribonucleoside 3'-(allyl N,N-diisopropylphosphoramidite)s or 3'-(2-cyanoethyl N,N-diisopropylphosphoramidite)s employed in the preparation of deoxyribonucleotides, and 3'-O-(tert-butyldimethylsilyl)ribonucleoside 2'-(N,N-diisopropylphosphoramidite)s or 2'-O-(tert-butyldimethylsilyl)ribonucleoside 3'-(N,N-diisopropylphosphoramidite)s used for the formation of 2'-5' and 3'-5' internucleotide linkages between ribonucleosides, respectively. The azolium salt has allowed smooth and high-yield condensation of the nucleoside phosphoramidite and a 5'-O-free nucleoside, in which equimolar amounts of the reactants and the promoter are employed in the presence of powdery molecular sieves 3A in acetonitrile. It has been shown that some azolium salts serve as excellent promoters in the solid-phase synthesis of oligodeoxyribonucleotides and oligoribonucleotides. For example, benzimidazolium triflate and N-(phenyl)imidazolium triflate can be used as effective promoters in the synthesis of an oligodeoxyribonucleotide, (5')CGACACCCAATTCTGAAAAT(3') (20mer), via a method using O-allyl/N-allyloxycarbonyl-protected deoxyribonucleoside 3'-phosphoramidites or O-(2-cyanoethyl)/N-phenoxyacetyl-protected deoxyribonucleotide 3'-phosphoramidite as building blocks, respectively, on high-cross-linked polystyrene resins. Further, N-(phenyl)imidazolium triflate is useful for the solid-phase synthesis of oligoribonucleotides, such as (5')AGCUACGUGACUACUACUUU(3') (20mer), according to an allyl/allyloxycarbonyl-protected strategy. The utility of the azolium promoter has been also demonstrated in the liquid-phase synthesis of some biologically important substances, such as cytidine-5'-monophosphono-N-acetylneuraminic acid (CMP-Neu5Ac) and adenylyl(2'-5')adenylyl(2'-5')adenosine (2-5A core).

No abstract

When Phanerochaete chrysosporium was grown with laminarin (a beta-1,3/1,6-glucan) as the sole carbon source, a beta-1,3-glucanase with a molecular mass of 36 kDa was produced as a major extracellular protein. The cDNA encoding this enzyme was cloned, and the deduced amino acid sequence revealed that this enzyme belongs to glycoside hydrolase family 16; it was named Lam16A. Recombinant Lam16A, expressed in the methylotrophic yeast Pichia pastoris, randomly hydrolyzes linear beta-1,3-glucan, branched beta-1,3/1,6-glucan, and beta-1,3-1,4-glucan, suggesting that the enzyme is a typical endo-1,3(4)-beta-glucanase (EC 3.2.1.6) with broad substrate specificity for beta-1,3-glucans. When laminarin and lichenan were used as substrates, Lam16A produced 6-O-glucosyl-laminaritriose (beta-D-Glcp-(1->6)-beta-D-Glcp-(1->3)-beta-D-Glcp-(1->3)-D-Glc) and 4-O-glucosyl-laminaribiose (beta-D-Glcp-(1->4)-beta-D-Glcp-(1->3)-D-Glc), respectively, as one of the major products. These results suggested that the enzyme strictly recognizes beta-D-Glcp-(1->3)-D-Glcp at subsites -2 and -1, whereas it permits 6-O-glucosyl substitution at subsite +1 and a beta-1,4-glucosidic linkage at the catalytic site. Consequently, Lam16A generates non-branched oligosaccharide from branched beta-1,3/1,6-glucan and, thus, may contribute to the effective degradation of such molecules in combination with other extracellular beta-1,3-glucanases.