In 2004 lettuce plants showing mosaic symptoms collected in São Manuel, SP were analyzed by electron microscopy, and particles with 730 nm typically from potyvirus were observed. After biological purification by monolesionals on Chenopodium quinoa, this isolate was sap inoculated on a host range assay. The virus infected C. quinoa and C. amaranticolor, causing local lesions and systemic mosaic. The virus did not induce symptoms on pea (Pisum sativum), but induced mosaic on the leaves of some lettuce cultivars such as Trocadero, White Boston, Regina, Verônica, Lucy Brown, Rafaela, Tainá, Vera and Laurel. The lettuce cultivar Gizele was tolerant to the virus. The coat protein gene was sequenced, and 97% aminoacids identity was observed with Bidens mosaic virus -BiMV (GenBank accession number AY960151). Differently of others previously BiMV isolates described, this isolate from lettuce was not able to infect Bidens pilosa, Helianthus annuus, Nicotiana tabacum TNN and N. glutinosa. The natural occurrence of BiMV infecting lettuce and causing mosaic symptoms similar to LMV, also the susceptibility of many lettuce cultivars to BiMV, could be an alert to the correct diagnosis of the viruses infecting this plant .
Spilanthes oleracea L., popularly known as toothache plant, belongs to the family Asteraceae and is a South American native plant. Fresh leaves can be eaten for their medicinal properties or used by the cosmetics industry for their spilol contents. Plants showing leaf deformation that were collected in a field in São Paulo State, Brazil in March 2005 were suspected to be infected by a virus. Electron microscopy of leaf dip preparations of symptomatic plants revealed pleiomorphic particles typical of tospoviruses. Extracts from these plants prepared with 0.01 M sodium phosphate buffer, pH 7.0, containing 1% sodium sulfite were mechanically inoculated to indicator plants. Chenopodium amaranticolor and Gomphrena globosa were symptomless. Necrotic local lesions were observed on C. quinoa. Necrotic local lesions followed by a systemic necrosis that caused the death of the plants were observed on Datura stramonium, Nicotiana glutinosa, and N. tabacum ‘TNN’ and ‘Turkish’. Concentric rings followed by systemic necrosis and plant death were induced on N. rustica, N. tabacum ‘Havana 425’, N. clevelandii, Physalis floridana, Capsicum annum ‘Magda’, and Solanum lycopersicum ‘Santa Clara’. Total RNA was extracted (1) from infected S. oleracea and N. rustica plants for reverse transcription-PCR amplification with tospovirus specific primers BR60 (5′ CCCGGATCCTGCAGAGCAATTGTGTCA 3′) and BR65 (5′ ATCAAGCCTTCTGAAAGTCAT 3′) (2), which amplified an approximate 440-bp fragment covering part of the nucleocapsid protein gene. This fragment was sequenced (EMBL Accession No. AM887766) and showed 99% nt sequence identity with Tomato chlorotic spot virus (TCSV) (GenBank Accession No. AF521102), a tospovirus species (3). To our knowledge, this is the first report of a tospovirus infecting S. oleracea in Brazil and indicates that this plant might constitute a reservoir of TCSV or other tospoviruses that could also infect tomato and pepper plants. References: (1) Y. D. Bertheau et al. DNA amplification by polymerase chain reaction (PCR) 1998 in: Methods for the Detection and Quantification of Erwinia carotovora subsp. atroseptica on Potatoes. M. C. N. Perombelon and J. M. van der Wolf, eds. Scott. Crop Res. Inst. Occas. Publ. Dundee, Scotland, 1998. (2) M. Eiras et al. Fitopatol. Bras. 26:170, 2001. (3) F. Lovato et al. Virus Genes 29:321, 2004.
scite is a Brooklyn-based organization that helps researchers better discover and understand research articles through Smart Citations–citations that display the context of the citation and describe whether the article provides supporting or contrasting evidence. scite is used by students and researchers from around the world and is funded in part by the National Science Foundation and the National Institute on Drug Abuse of the National Institutes of Health.
hi@scite.ai
10624 S. Eastern Ave., Ste. A-614
Henderson, NV 89052, USA
Copyright © 2024 scite LLC. All rights reserved.
Made with 💙 for researchers
Part of the Research Solutions Family.