A high proportion of patients with myeloproliferative disorders carry a dominant gain-of-function mutation of JAK2.

Elucidation of the mutational landscape of human cancer has progressed rapidly and been accompanied by the development of therapeutics targeting mutant oncogenes. However, a comprehensive mapping of cancer dependencies has lagged behind and the discovery of therapeutic targets for counteracting tumor suppressor gene loss is needed. To identify vulnerabilities relevant to specific cancer subtypes, we conducted a large-scale RNAi screen in which viability effects of mRNA knockdown were assessed for 7,837 genes using an average of 20 shRNAs per gene in 398 cancer cell lines. We describe findings of this screen, outlining the classes of cancer dependency genes and their relationships to genetic, expression, and lineage features. In addition, we describe robust gene-interaction networks recapitulating both protein complexes and functional cooperation among complexes and pathways. This dataset along with a web portal is provided to the community to assist in the discovery and translation of new therapeutic approaches for cancer.

To generate transgenic mice that express Cre-recombinase exclusively in the megakaryocytic lineage, we modified a mouse bacterial artificial chromosome (BAC) clone by homologous recombination and replaced the first exon of the platelet factor 4 (Pf4), also called CXCL4, with a codon-improved Cre cDNA. Several strains expressing the transgene were obtained and one strain, Q3, was studied in detail. Crossing Q3 mice with the ROSA26-lacZ reporter strain showed that Cre-recombinase activity was confined to megakaryocytes. These results were further verified by crossing the Q3 mice with a strain containing loxP-flanked integrin ␤1. Excision of this conditional allele in megakaryocytes was complete at the DNA level, and platelets were virtually devoid of the integrin ␤1 protein. The Pf4-Cre transgenic strain will be a valuable tool to study megakaryopoiesis, platelet formation, and platelet function. IntroductionDeletion of ubiquitously expressed genes often results in severe phenotypes that interfere with the analysis of particular cell types or tissues. 1 To overcome this limitation, conditional gene inactivation with the loxP-Cre system has been widely used. Several genes that are expressed in the megakaryocytic lineage have been described, including GpIIb (CD41), GpIIIa (CD61), and platelet factor 4 (Pf4). 2,3 The promoters of these genes can be used to direct expression of transgenes to megakaryocytes and precursors. [4][5][6][7] Classical transgenes with relatively short promoters are known to be prone to silencing and position effect variegation, resulting in mosaic expression, whereas copy number-dependent and positionindependent transgene expression was reported when large genomic fragments that contain the promoter of choice were used. [8][9][10] Here, we describe the generation of transgenic mice that exclusively express Cre-recombinase in megakaryocytes. To achieve specific Cre expression, we used a bacterial artificial chromosome (BAC) clone containing the entire mouse Pf4 promoter. Materials and methods Transgenic miceThe Pf4-Cre transgene construct was generated by homologous recombination in bacteria (for details, see legend to Figure S1, available on the Blood website; see the Supplemental Materials link at the top of the online article). 11 BAC DNA from the final construct was purified using the Nucleobond AX 500 DNA purification kit (Macherey-Nagel, Düren, Germany). An approximately 100-kb (kilobase) NotI fragment harboring the Cre cDNA was separated from the vector by pulsed-field gel electrophoresis prior to microinjection into C57BL/6 oocytes. Genotyping was performed using a forward primer located in the Pf4-promotor (CCCATACAGCACACCTTTTG) and a reverse primer in the Cre-cDNA (TGCACAGTCAGCAGGTT) yielding a 450-bp polymerase chain reaction (PCR) product. ROSA26-lacZ mice were purchased from Jackson Laboratories (Bar Harbor, ME). 12 Integrin ␤1 lox mice were received from Dr Ulrich Müller (Scripps Research Institute, La Jolla, CA). 13 RNATotal RNA was isolated with TriFast (PeqLab, Erlangen, Germ...

An acquired somatic mutation in the JAK2 gene (JAK2-V617F) is present in the majority of patients with myeloproliferative disorders (MPDs). Several phenotypic manifestations (polycythemia vera [PV], essential thrombocythemia [ET], and primary myelofibrosis) can be associated with the same mutation. We generated JAK2-V617F transgenic mice using a human JAK2 gene with the sequences encoding the kinase domain placed in the inverse orientation and flanked by antiparallel loxP sites. Crossing mice of one transgenic line (FF1) with transgenic mice expressing Cre-recombinase under the control of the hematopoiesis specific Vav promoter led to expression of JAK2-V617F that was lower than the endogenous wild-type Jak2. These mice developed a phenotype resembling ET with strongly elevated platelet counts and moderate neutrophilia. Induction of the JAK2-V617F transgene with the interferoninducible MxCre resulted in expression of JAK2-V617F approximately equal to wildtype Jak2 and a PV-like phenotype with increased hemoglobin, thrombocytosis, and neutrophilia. Higher levels of JAK2-V617F in mouse bone marrow by retroviral transduction caused a PV-like phenotype without thrombocytosis. These data are consistent with the hypothesis that the ratio of mutant to wild-type JAK2 is critical for the phenotypic manifestation. IntroductionAn acquired somatic mutation in the JAK2 gene resulting in a valine to phenylalanine substitution at position 617 (JAK2-V617F) is present in the majority of patients with myeloproliferative disorders (MPDs). [1][2][3][4] This discovery suggested that the presence of the JAK2-V617F mutation could represent the primary causative lesion in MPD. While the JAK2-V617F mutation is found in approximately 95% of patients with polycythemia vera (PV), it is also detectable in about 50% of patients with primary myelofibrosis (PMF) and essential thrombocythemia (ET). 2,5 It remains unclear how the identical JAK2-V617F mutation can cause 3 distinct clinical entities. In patients with PV and PMF, but only rarely in ET, the JAK2-V617F mutation progresses from the heterozygous state to homozygosity through mitotic recombination of the distal part of chromosome 9p. 4,6 Retroviral transduction of mouse bone marrow cells followed by transplantation into lethally irradiated mice demonstrated that the expression of Jak2-V617F is sufficient to induce a phenotype resembling PV. 1,7-10 These mice showed massive increase in hematocrit and hemoglobin concentration and a variable degree of neutrophilia. In contrast to patients with PV, the platelet numbers in these mice remained normal or were even decreased. After several months some of the mice also developed myelofibrosis. The phenotype was not affected when bone marrow from donor mice deficient for the Src family kinases Lyn, Hck and Fgr were used, but was dependent on the presence of Stat5. 10,11 To establish a mouse model for MPD we generated bacterial artificial chromosome (BAC) transgenic mice that express the human JAK2-V617F driven by the JAK2 promoter. A constitutiv...

Genetic alterations in the fibroblast growth factor receptor (FGFR) pathway are promising therapeutic targets in many cancers, including intrahepatic cholangiocarcinoma (ICC). The FGFR inhibitor BGJ398 displayed encouraging efficacy in patients with FGFR2 fusion-positive ICC in a phase II trial, but the durability of response was limited in some patients. Here, we report the molecular basis for acquired resistance to BGJ398 in three patients via integrative genomic characterization of cell-free circulating tumor DNA (cfDNA), primary tumors, and metastases. Serial analysis of cfDNA demonstrated multiple recurrent point mutations in the FGFR2 kinase domain at progression. Accordingly, biopsy of post-progression lesions and rapid autopsy revealed marked inter- and intra-lesional heterogeneity, with different FGFR2 mutations in individual resistant clones. Molecular modeling and in vitro studies indicated that each mutation lead to BGJ398 resistance and was surmountable by structurally distinct FGFR inhibitors. Thus, polyclonal secondary FGFR2 mutations represent an important clinical resistance mechanism that may guide development of future therapeutic strategies.

Integrins are critical for hemostasis and thrombosis because they mediate both platelet adhesion and aggregation. Talin is an integrin-binding cytoplasmic adaptor that is a central organizer of focal adhesions, and loss of talin phenocopies integrin deletion in Drosophila. Here, we have examined the role of talin in mammalian integrin function in vivo by selectively disrupting the talin1 gene in mouse platelet precursor megakaryocytes. Talin null megakaryocytes produced circulating platelets that exhibited normal morphology yet manifested profoundly impaired hemostatic function. Specifically, platelet-specific deletion of talin1 led to spontaneous hemorrhage and pathological bleeding. Ex vivo and in vitro studies revealed that loss of talin1 resulted in dramatically impaired integrin αIIbβ3-mediated platelet aggregation and β1 integrin–mediated platelet adhesion. Furthermore, loss of talin1 strongly inhibited the activation of platelet β1 and β3 integrins in response to platelet agonists. These data establish that platelet talin plays a crucial role in hemostasis and provide the first proof that talin is required for the activation and function of mammalian α2β1 and αIIbβ3 integrins in vivo.

Hsp90 inhibition in B cell acute lymphoblastic leukemia overcomes resistance to JAK2 inhibitors.

Mutations in the MYH9 gene encoding the nonmuscle myosin heavy chain IIA result in bleeding disorders characterized by a macrothrombocytopenia. To understand the role of myosin in normal platelet functions and in pathology, we generated mice with disruption of MYH9 in megakaryocytes. MYH9⌬ mice displayed macrothrombocytopenia with a strong increase in bleeding time and absence of clot retraction. However, platelet aggregation and secretion in response to any agonist were near normal despite absence of initial platelet contraction. By contrast, integrin outside-in signaling was impaired, as observed by a decrease in integrin ␤3 phosphorylation and PtdIns(3,4)P 2 accumulation following stimulation. Upon adhesion on a fibrinogen-coated surface, MYH9⌬ platelets were still able to extend lamellipodia but without stress fiber-like formation. As a consequence, thrombus growth and organization, investigated under flow by perfusing whole blood over collagen, were strongly impaired. Thrombus stability was also decreased in vivo in a model of FeCl 3 -induced injury of carotid arteries. Overall, these results demonstrate that while myosin seems dispensable for aggregation and secretion in suspension, it plays a key role in platelet contractile phenomena and outsidein signaling. These roles of myosin in platelet functions, in addition to thrombocytopenia, account for the strong hemostatic defects observed in MYH9⌬ mice. IntroductionImportant morphologic changes occur in platelets during their activation at sites of vascular injury. The cells lose their resting discoid shape to become spheroid and contracted, emitting membrane blebs and longer extensions. [1][2][3][4] Once in contact with a surface, the spheroid platelets extend long filopodia and finally spread over it by emitting thin, sheet-like lamellipodia. 1,2 Myosin activation plays a central role in the cytoskeletal rearrangements underlying these changes in morphology. Myosin becomes activated after phosphorylation of the myosin regulatory light chain (RLC), which results from both calcium-regulated myosin lightchain kinase activity and Rho kinase-regulated myosin phosphatase activity. [5][6][7][8] Activated myosin assembles into short filaments through the myosin heavy chain and interacts mainly with central actin filaments. Myosin has been proposed to participate in several platelet contractile functions such as platelet spheration, contraction and stress-fiber formation, and fibrin clot retraction. Platelet spheration and contraction, as observed in the aggregometer, closely correlate with phosphorylation of the RLC 9,10 and are prevented when RLC phosphorylation is inhibited. 6,7,9,10 Myosin has also been shown to be associated with stress fiber-like structures in spreading adherent platelets. 11 In addition, myosin could play a role in platelet secretion, as it is decreased by inhibition of myosin RLC phosphorylation. 5,[12][13][14][15] Finally, a role of myosin in clot retraction has long been suspected in view of the necessity for a contractile force and was ...