In early 2013, greenhouse cucumber growers in Alberta, Canada, observed virus-like disease symptoms on mini-cucumber (Cucumis sativus) crops (e.g., ‘Picowell’). Two types of symptoms were commonly observed, green mottle mosaic and necrotic spots. In the early infection, young leaves of infected cucumber plants displayed light green mottle and blisters. The infected plants were stunted in growth, with darker green blisters and green mottle mosaic symptoms on mature leaves. Disease incidence varied from one greenhouse to another. In some severe cases, diseased plants were widely distributed inside the greenhouse, resulting in 10 to 15% yield losses based on grower's estimation. Nine symptomatic samples were collected and subjected to total RNA isolation using the TRIzol reagent (Invitrogen, Carlsbad, CA). Laboratory analyses were conducted using real-time RT-PCR systems for Cucumber green mottle mosaic virus (CGMMV) (1), Melon necrotic spot virus (MNSV, Ling, unpublished), and Squash mosaic virus (SqMV) (3). All nine samples were positive for CGMMV and seven of them were in mixed infections with MNSV. Two samples were selected for validation for the presence of CGMMV using conventional RT-PCR (2) with a new primer set (CGMMVMP F1: 5′-ATGTCTCTAAGTAAGGTGTC-3′ and CGMMV3′UTR R1: 5′-TGGGCCCCTACCCGGGG-3′) and two previous online published primer sets, one for CGMMV MP (5′ TAAGTTTGCTAGGTGTGATC-3′, GenBank Accession No. AJ250104 and 5′ ACATAGATGTCTCTAAGTAAG-3′, AJ250105), and another for CGMMV CP (5′ ACCCTCGAAACTAAGCTTTC-3′, AJ243351 and 5′ GAAGAGTCCAGTTCTGTTTC-3′, AJ243352). The expected sizes of RT-PCR products were obtained and sequenced directly. Sequences from these three products overlapped and generated a 1,282-bp contig (KF683202). BLASTn analysis to the NCBI database showed 99% sequence identity to CGMMV isolates identified in Asia, including China (GQ277655, KC852074), India (DQ767631), Korea (AF417243), Myanmar (AB510355), and Taiwan (HQ692886), but only 92% sequence identity to other CGMMV isolates identified in Europe, including Spain (GQ411361) and Russia (GQ495274), and 95% to CGMMV isolate from Israel (KF155231). The strong sequence identity to the CGMMV Asian isolates suggests that the Canadian CGMMV isolate identified in Alberta was likely of Asian origin. In two bioassay experiments using one sample prepared in 0.01 M phosphate buffer, the similar green mottle mosaic symptoms were observed on systemic leaves in the mechanically inoculated plants and the presence of CGMMV, but not MNSV, was confirmed through real-time RT-PCR on four different cucurbits, including three Cucumis sativus cultivars (six plants in ‘Marketer,’ five plants in ‘Poinsett 76,’ six plants in ‘Straight 8’), seven plants of C. melo ‘Athena,’ six plants of C. metulifer (PI201681), and two plants of Citrullus lanatus ‘Charleston Gray.’ To our knowledge, CGMMV has only been reported in Asia, Europe, and the Middle East, and this is the first report of CGMMV in the American continents. CGMMV is highly contagious and is seed borne on cucurbits. With the increasing trend in growing grafted watermelon and other cucurbits in the United States and elsewhere, it is even more important now that a vigilant seed health test program for CGMMV should be implemented. References: (1) H. Chen et al. J. Virol. Methods 149:326, 2008. (2) K.-S. Ling et al. Plant Dis. 92:1683, 2008. (3) K.-S. Ling et al. J. Phytopathol. 159:649, 2011.
In spring 2012, a severe disease was observed on a limited number of tomato plants (Solanum lycopersicum L.) in a research greenhouse facility in western North Carolina. The first symptoms noted were downward curling of the terminal leaves accompanied by a rough puckered darker green texture. This was followed in time by greater distortion of the leaves with pale green on leaf margins. Older leaves with symptoms developed necrosis, with necrotic spots and streaks appearing on a few fruits. On some of these affected fruits, stems, peduncles, pedicels, and sepals also showed symptoms. Infected plants were badly stunted, and fruits in the upper parts of plants displaying severe symptoms remained very small. In just a few months, the disease spread to other tomato plants inside the greenhouse. A survey in May 2012 showed a disease incidence of 18% (156 symptomatic plants out of a total of 864) in this greenhouse. Initial screenings for possible viruses using ELISA (Agdia, Elkhart, IN), as well as a reverse transcription (RT)-PCR panel of 15 common tomato viruses in our laboratory were negative. Because of the symptoms and negative results for viruses, a viroid infection was suspected. Total plant RNA was prepared using TRIzol reagent (Invitrogen, Carlsbad, CA) from leaf tissues of eight diseased plants and one seed sample. Using real-time RT-PCR developed against Potato spindle tuber viroid (PSTVd) and some related pospiviroids (1), positive signals were observed with a mean Ct = 13.24 for leaf tissues and Ct = 19.91 for the seed sample. To obtain a full viroid genome, RT-PCR using two different sets of primers, one specific for PSTVd (PSTVd-F and PSTVd-R) (2), and a universal primer set for pospiviroids (MTTVd-F and MTTVd-R) (3) was performed. RT-PCR generated amplicons with expected size of ~360 bp from all eight leaf and one seed samples, but not from a healthy control. PCR products were cloned using the TOPO TA cloning kit (Invitrogen, Carlsbad, CA). A total of 22 full genomic sequences were obtained. A multi-sequence alignment generated a consensus sequence of 360 nt, designated as NC12-01 (GenBank Accession No. JX280944). BLASTn search in the NCBI database revealed the highest sequence identity of 96.9% to Australian (AY962324) and UK (AJ583449) isolates of PSTVd and 95.9% identity to the tomato isolate of PSTVd-CA1 (HM753555). Similar disease symptoms were observed on two ‘Rutgers’ tomato plants 2 weeks post mechanical inoculation and the presence of PSTVd was confirmed by real-time RT-PCR (1). A mock-inoculated plant did not show any symptoms. In the U.S., natural infection of PSTVd on tomato was first identified in California in 2010 (3). To our knowledge, this is the first report of a natural occurrence of PSTVd on tomato in the eastern U.S. The diseased plants were contained, properly disposed of, and eradicated in this location. The broader geographic distribution of PSTVd on tomato in the U.S., and the potential latent infection in potato and a number of ornamentals (4), emphasizes the need for better plant and seed health tests for viroids on these plants. References: (1) N. Boonham et al. J. Virol. Methods 116:139, 2004. (2) H. Bostan et al. J. Virol. Methods 116:189, 2004. (3) K.-S. Ling and D. Sfetcu. Plant Dis. 94:1376, 2010. (4) R. A. Owens and J. Th. J. Verhoeven. The Plant Health Instructor. DOI: 10.1094/PHI-I-2009-0804-01, 2009.
In recent years, viroid disease outbreaks have resulted in serious economic losses to a number of tomato growers in North America (1,2,3). At least three pospiviroids have been identified as the causal agents of tomato disease, including Potato spindle tuber viroid (PSTVd), Tomato chlorotic dwarf viroid (TCDVd), and Mexican papita viroid (MPVd). In the spring of 2013, a severe disease outbreak with virus-like symptoms (chlorosis and plant stunting) was observed in a tomato field located in the Dominican Republic, whose tomato production is generally exported to the United States in the winter months. The transplants were produced in house. The disease has reached an epidemic level with many diseased plants pulled and disposed of accordingly. Three samples collected in May of 2013 were screened by ELISA against 16 common tomato viruses (Alfalfa mosaic virus, Cucumber mosaic virus, Impatiens necrotic spot virus, Pepino mosaic virus, Potato virus X, Potato virus Y, Tobacco etch virus, Tobacco mosaic virus, Tobacco ringspot virus, Tomato aspermy virus, Tomato bushy stunt virus, Tomato mosaic virus, Tomato ringspot virus, Tomato spotted wilt virus, Groundnut ringspot virus, and Tomato chlorotic spot virus), a virus group (Potyvirus group), three bacteria (Clavibacter michiganensis subsp. michiganensis, Pectobacterium atrosepticum, and Xanthomonas spp.), and Phytophthora spp. No positive result was observed, despite the presence of symptoms typical of a viral-like disease. Further analysis by RT-PCR using Agdia's proprietary pospiviroid group-specific primer resulted in positive reactions in all three samples. To determine which species of pospiviroid was present in these tomato samples, full-genomic products of the expected size (~360 bp) were amplified by RT-PCR using specific primers for PSTVd (4) and cloned using TOPO-TA cloning kit (Invitrogen, CA). A total of 8 to 10 clones from each isolate were selected for sequencing. Sequences from each clone were nearly identical and the predominant sequence DR13-01 was deposited in GenBank (Accession No. KF683200). BLASTn searches into the NCBI database demonstrated that isolate DR13-01 shared 97% sequence identity to PSTVd isolates identified in wild Solanum (U51895), cape gooseberry (EU862231), or pepper (AY532803), and 96% identity to the tomato-infecting PSTVd isolate from the United States (JX280944). The relatively lower genome sequence identity (96%) to the tomato-infecting PSTVd isolate in the United States (JX280944) suggests that PSTVd from the Dominican Republic was likely introduced from a different source, although the exact source that resulted in the current disease outbreak remains unknown. It may be the result of an inadvertent introduction of contaminated tomato seed lots or simply from local wild plants. Further investigation is necessary to determine the likely source and route of introduction of PSTVd identified in the current epidemic. Thus, proper control measures could be recommended for disease management. The detection of this viroid disease outbreak in the Dominican Republic represents further geographic expansion of the viroid disease in tomatoes beyond North America. References: (1). K.-S. Ling and M. Bledsoe. Plant Dis. 93:839, 2009. (2) K.-S. Ling and W. Zhang. Plant Dis. 93:1216, 2009. (3) K.-S. Ling et al. Plant Dis. 93:1075, 2009. (4) A. M. Shamloul et al. Can. J. Plant Pathol. 19:89, 1997.
Virus-like symptoms including deformation, discoloration, and necrotic ringspots on green and red fruits of tomato (Solanum lycopersicum L. cv. Big Dena) were observed in a 400 m2 commercial high tunnel in Wayne Co., Ohio, in July and August 2013. No symptoms were observed on leaves. Incidence of symptomatic fruits was approximately 15%. Tomato seedlings transplanted into the high tunnel were produced in a greenhouse containing ornamental plants. The grower observed high levels of thrips infestation in the tomato seedlings prior to transplanting. A tospovirus was suspected as a possible causal agent. Four symptomatic fruits were tested using immunostrip tests for Tomato spotted wilt virus (TSWV) and Impatiens necrotic spot virus (INSV) (Agdia, Inc., Elkhart, IN), a double antibody sandwich enzyme-linked immunosorbent assay (DAS-ELISA) for Groundnut ringspot virus (GRSV)/Tomato chlorotic spot virus (TCSV) (Agdia, Inc., Elkhart, IN), and DAS-ELISA for TCSV (AC Diagnostics Inc., Fayetteville, AR). All of the symptomatic fruits tested negative with Agdia immunostrips and positive with the Agdia and AC Diagnostics DAS-ELISAs. Total RNA was extracted from one ELISA-positive sample using TRIZOL Reagent (Life Technologies, Carlsbad, CA) and tested in RT-PCR using GRSV- or TCSV-specific primers (2). An expected RT-PCR product was generated using primers derived from TCSV S-RNA (JAP885, 5′-CTCGGTTTTCTGCTTTTC-3′ and JAP886, 5′CGGACAGGCTGGAGAAATCG3′) (~290 bp) but not when using primers specific to GRSV S-RNA (JAP887, 5′-CGTATCTGAGGATGTTGAGT-3′ and JAP888, 5′-GCTAACTCCTTGTTCTTTTG-3′). The 290-bp RT-PCR product was cloned using a TOPO TA cloning kit (Life Technologies, Grand Island, NY), and six clones were sequenced. Sequences from three clones were identical to a consensus sequence of a 292-bp fragment covering part of the TCSV nucleocapsid gene (GenBank Accession No. KJ744213). Sequences of the remaining three clones contained one, two, or three nucleotide mutations. To confirm the presence of TCSV in this sample, two newly designed primers flanking the entire nucleocapsid protein gene (TCSV-F1, 5′-AGTATTATGCATCTATAGATTAGCACA-3′ and TCSV-R1, 5′-ACAAATCATCACATTGCCAGGA-′) were used in RT-PCR to generate an expected 948-bp product. Upon cloning and sequencing, this fragment was shown to contain a full nucleocapsid protein gene of TCSV (GenBank Accession No. KM610235). The fragment contained a sequence identical to the first 292-bp RT-PCR product. BLASTn analysis (National Center for Biotechnology Information database) showed that the large fragment sequence had 98% nucleotide sequence identity to the TCSV Florida isolate (GenBank Accession No. JX244196) and 94% to the TCSV Physalis isolate (GenBank Accession No. JQ034525). Tobacco plants were inoculated mechanically with sap from symptomatic tomato fruits. Necrotic local lesions developed, and the presence of TCSV was confirmed using AC Diagnostics' DAS-ELISA. TCSV has been reported in Brazil (1), Puerto Rico (3), and Florida (2). To our knowledge, this is the first report of TCSV infecting tomatoes in Ohio. Because TCSV is transmitted by thrips and has a broad host range, this emerging virus could pose a significant threat to the U.S. vegetable industry. References: (1) A. Colariccio et al. Fitopatol. Bras. 20:347, 1995. (2) A. Londoño et al. Trop. Plant Pathol. 37:333, 2012. (3) C. G. Webster et al. Plant Health Progress doi:10.1094/PHP-2013-0812-01-BR, 2013.
scite is a Brooklyn-based organization that helps researchers better discover and understand research articles through Smart Citations–citations that display the context of the citation and describe whether the article provides supporting or contrasting evidence. scite is used by students and researchers from around the world and is funded in part by the National Science Foundation and the National Institute on Drug Abuse of the National Institutes of Health.
customersupport@researchsolutions.com
10624 S. Eastern Ave., Ste. A-614
Henderson, NV 89052, USA
Copyright © 2024 scite LLC. All rights reserved.
Made with 💙 for researchers
Part of the Research Solutions Family.