Molecular methods for the rapid identification of methicillin-resistant Staphylococcus aureus (MRSA) are generally based on the detection of an S. aureus-specific gene target and the mecA gene. However, such methods cannot be applied for the direct detection of MRSA from nonsterile specimens such as nasal samples without the previous isolation, capture, or enrichment of MRSA because these samples often contain both coagulasenegative staphylococci (CoNS) and S. aureus, either of which can carry mecA. In this study, we describe a real-time multiplex PCR assay which allows the detection of MRSA directly from clinical specimens containing a mixture of staphylococci in <1 h. Five primers specific to the different staphylococcal cassette chromosome mec (SCCmec) right extremity sequences, including three new sequences, were used in combination with a primer and three molecular beacon probes specific to the S. aureus chromosomal orfX gene sequences located to the right of the SCCmec integration site. Of the 1,657 MRSA isolates tested, 1,636 (98.7%) were detected with the PCR assay, whereas 26 of 569 (4.6%) methicillin-susceptible S. aureus (MSSA) strains were misidentified as MRSA. None of the 62 nonstaphylococcal bacterial species or the 212 methicillin-resistant or 74 methicillinsusceptible CoNS strains (MRCoNS and MSCoNS, respectively) were detected by the assay. The amplification of MRSA was not inhibited in the presence of high copy numbers of MSSA, MRCoNS, or MSCoNS. The analytical sensitivity of the PCR assay, as evaluated with MRSA-negative nasal specimens containing a mixture of MSSA, MRCoNS, and MSCoNS spiked with MRSA, was ϳ25 CFU per nasal sample. This real-time PCR assay represents a rapid and powerful method which can be used for the detection of MRSA directly from specimens containing a mixture of staphylococci.

Microbiome studies have demonstrated the high inter-individual diversity of the gut microbiota. However, how the initial composition of the microbiome affects the impact of antibiotics on microbial communities is relatively unexplored. To specifically address this question, we administered a second-generation cephalosporin, cefprozil, to healthy volunteers. Stool samples gathered before antibiotic exposure, at the end of the treatment and 3 months later were analysed using shotgun metagenomic sequencing. On average, 15 billion nucleotides were sequenced for each sample. We show that standard antibiotic treatment can alter the gut microbiome in a specific, reproducible and predictable manner. The most consistent effect of the antibiotic was the increase of Lachnoclostridium bolteae in 16 out of the 18 cefprozil-exposed participants. Strikingly, we identified a subgroup of participants who were enriched in the opportunistic pathogen Enterobacter cloacae after exposure to the antibiotic, an effect linked to lower initial microbiome diversity and to a Bacteroides enterotype. Although the resistance gene content of participants' microbiomes was altered by the antibiotic, the impact of cefprozil remained specific to individual participants. Resistance genes that were not detectable prior to treatment were observed after a 7-day course of antibiotic administration. Specifically, point mutations in beta-lactamase blaCfxA-6 were enriched after antibiotic treatment in several participants. This suggests that monitoring the initial composition of the microbiome before treatment could assist in the prevention of some of the adverse effects associated with antibiotics or other treatments.

The presence of Enterococcus-associated vancomycin resistance genes vanA, vanB, vanD, vanE, and vanG in rectal swabs was investigated in two hospitals using PCR. All vanA genes detected were associated with vancomycin-resistant enterococci (VRE), whereas VRE-associated vanB genes were detected in only one hospital (4.7%). However, in both hospitals, high prevalences of vanB (6.2 and 2.3%), vanD (43.8 and 26.7%), and vanG (10.5 and 6.9%) genes not associated with enterococci were found.Since their first appearance in 1988, vancomycin-resistant enterococci (VRE) have emerged worldwide and have become an increasing problem in clinical settings (5). Acquired glycopeptide resistance in Enterococcus species is due to the acquisition of vanA, vanB, vanD, vanE, and vanG genes, resulting in the production of peptidoglycan precursors with reduced affinity for glycopeptide antibiotics (7). The origin of these van genes is still unknown, but recent studies have indicated that vanB resistance in enterococci might arise from gene transfer from the human bowel flora (1)(2)(3)6). In this study, we investigated the presence of Enterococcus-associated vanA, vanB, vanD, vanE, and vanG genes in human rectal swabs.Two rectal swabs each obtained from 162 patients at the Hôpital Général de Montréal (HGM) (Montréal, Québec, Canada) and one rectal swab each obtained from 86 patients at the Massachusetts General Hospital (MGH) (Boston, Mass.) were used to detect van-associated enterococci. One of the two swabs from each patient at HGM and each swab from MGH were suspended in 1 ml of buffer, and 50 l of this suspension was used for DNA extraction as previously described (4). Conventional PCR amplifications were performed with crude DNA extracts prepared from each rectal swab using primer pairs specific to vanA (forward, AATAGCGCGGACGAA TTGGAC; reverse, AACGCGGCACTGTTTCCCAA), vanB (forward, CTTAACGCTGCGATAGAAGC; reverse, CTG ATGGATGCGGAAGATAC), vanD (forward, TTTGTA AAGCCTGCCCGTTC; reverse, CCAAGTAYCCGGTAA ATCTTC), vanE (forward, AAATAATGCTCCATCAAT TTGCTGA; reverse, ATAGTCGAAAAAGCCATCCAC AAG), or vanG (forward, TTGGAGGCAATTCAACAG AGT; reverse, TCGCAGCCAACAACAGGTATT) genes. The PCR conditions were as previously described (4), except for the annealing temperatures, which varied from 58°C to 60°C depending on the van-specific primers used. Coamplification of a 250-bp fragment of plasmid M13pSL3 served as an internal control in all PCRs (4). Strict precautions to prevent carryover of amplified DNA and appropriate control reactions were used (4). The detection limit for each primer pair was approximately 5 genome copies per PCR.To recover van-associated enterococcal isolates from rectal swabs, a 300-l aliquot of the swab suspension was used to inoculate 10 ml of Enterococcosel broth (Becton Dickinson, Cockeysville, MD) containing 6 mg/liter vancomycin and 60 mg/liter aztreonam (EBVA), which was incubated aerobically for 24 h at 35°C. The other swab from each patient at HGM was placed directly into 10 ml of EBVA and incubated for 24 h at 35°C. ...

Our report shows for the first time the presence of a Tn5382-like transposon carrying vanB2 in a Clostridium species of the human intestinal flora. This suggests that the vanB2 Tn5382-like transposon is an important vector for the spread of vancomycin resistance in several bacterial species.

A vancomycin-resistant, anaerobic, gram-positive coccus containing the vanD and vanG-like genes (strain CCRI-16110) was isolated from a human fecal specimen during a hospital surveillance program to detect carriers of vancomycin-resistant enterococci. Comparison of the 16S rRNA gene sequence of strain CCRI-16110 with databases revealed a potentially novel Ruminococcus species that was most similar (<94% identity) to Clostridium and Ruminococcus species. Strain CCRI-16110 was highly resistant to vancomycin and teicoplanin (MICs of >256 g/ml). The complete DNA sequence of the vanD cluster was most similar (98.2% identity) to that of Enterococcus faecium BM4339, containing the vanD1 allele. An intD gene with 99% identity with that of this E. faecium strain was found to be associated with the vanD gene cluster of this novel anaerobic bacterium. Strain CCRI-16110 also harbors genes encoding putative VanS G , VanG, and VanT G proteins displaying 56, 73.6, and 55% amino acid sequence identity, respectively, compared to the corresponding proteins encoded by the vanG1 and vanG2 operons of Enterococcus faecalis BM4518 and N03-0233. This study reports for the first time an anaerobic bacterium containing the vanD gene cluster. This strain also harbors a partial vanG-like gene cluster. The presence of vanD-and vanG-containing anaerobic bacteria in the human bowel flora suggests that these bacteria may serve as a reservoir for the vanD and vanG vancomycin resistance genes.The glycopeptide antibiotics vancomycin and teicoplanin interfere with cell wall synthesis in gram-positive bacteria by binding to the terminal dipeptide D-alanyl-D-alanine regions of the pentapeptide precursors of peptidoglycan side chains. Resistance to glycopeptide antibiotics was first described for enterococci (23, 35) and has now spread worldwide. Six different genes (vanA, vanB, vanC, vanD, vanE, and vanG) have been shown to confer glycopeptide resistance in enterococci (7).The VanD-type resistance is constitutively expressed in enterococci (8, 11) and is characterized by moderate MICs of vancomycin (64 to 128 g/ml) and teicoplanin (4 to 64 g/ml). This VanD-type resistance results from the acquisition of the vanR D , vanS D , vanY D , vanH D , vanD, and vanX D cluster of genes, which directs synthesis of peptidoglycan precursors terminating in D-alanyl-D-lactate (11). The vanD gene cluster is located on the chromosome and is not transferable to other enterococci by conjugation in vitro (11). The VanD-type resistance in enterococci is also characterized by the presence of an impaired D-alanyl-D-alanine (Ddl) ligase due to mutations in the chromosomal ligase-encoding gene ddl (10). Although the Ddl ligase is inactive, the VanD-type enterococci are able to grow even in the absence of glycopeptide because the vanD cluster is expressed constitutively as a result of mutations in the VanS D sensor or in the VanR D regulator (10).The VanG-type resistance in enterococci is characterized by low-level resistance to vancomycin (MIC, 16 g/ml) and susceptibility t...