Platinum chemotherapeutic agents, such as cisplatin (cis-diamminedichloroplatinum(II)), can act as radiosensitizers when bound covalently to nuclear DNA in cancer cells. This radiosensitization is largely due to an increase in DNA damage induced by low-energy secondary electrons, produced in large quantities by high-energy radiation. We report the yields of single-and doublestrand breaks (SSB and DSB) and interduplex cross-links (CL) induced by electrons of 1.6-19.6 eV (i.e., the yield functions) incident on 5 monolayer (ML) films of cisplatin-DNA complexes. These yield functions are compared with those previously recorded with 5 ML films of unmodified plasmid DNA. Binding of five cisplatin molecules to plasmid DNA (3197 base pairs) enhances SSB, DSB, and CL by factors varying, from 1.2 to 2.8, 1.4 to 3.5, and 1.2 to 2.7, respectively, depending on electron energy. All yield functions exhibit structures around 5 and 10 eV that can be attributed to enhancement of bond scission, via the initial formation of core-excited resonances associated with π → π* transitions of the bases. This increase in damage is interpreted as arising from a modification of the parameters of the corresponding transient anions already present in nonmodified DNA, particularly those influencing molecular dissociation. Two additional resonances, specific to cisplatin-modified DNA, are formed at 13.6 and 17.6 eV in the yield function of SSB. Furthermore, cisplatin binding causes the induction of DSB by electrons of 1.6-3.6 eV, i.e., in an energy region where a DSB cannot be produced by a single electron in pure DNA. Breaking two bonds with a subexcitation-energy electron is tentatively explained by a charge delocalization mechanism, where a single electron occupies simultaneously two σ* bonds linking the Pt atom to guanine bases on opposite strands.

The development of cisplatin and Pt-based analogues anticancer agents requires knowledge concerning the molecular mechanisms of interaction between such drugs with DNA. However, the binding dynamics and kinetics of cisplatin reactions with DNA determined by traditional approaches are far from satisfactory. In this study, a typical 20-base oligonucleotide (CGTGACAGTTATTGCAGGCG), as a simplified model representing DNA, was mixed with cisplatin in different molar ratios and incubation time. High-resolution XPS spectra of the core elements C, N, O, P, and Cl were recorded to explore the interaction between cisplatin and DNA. From deconvoluted Cl spectra we could readily differentiate the covalently bound chlorine from ionic chloride species in the cisplatin-oligo complexes, which displayed distinct features at various reaction times and ratios. Monitoring the magnitude and energy of the photoelectron Cl 2p signal by XPS could act as a sensitive marker to probe the interaction dynamics of chemical bonds in the reaction of cisplatin with DNA. At 37°C, the optimum incubation time to obtain a stable cisplatin-oligo complex lies around 20 hrs. This novel analysis technique could have valuable implications to understand the fundamental mechanism of cisplatin cytotoxicity and determine the efficiency of the bonds in treated cancer cells.

The sensitivity of two conformations of plasmid DNA, the A and B forms, to strand break formation induced by gold nanoparticles (GNPs) is investigated by varying the GNP to DNA ratio in solution and the degree of DNA hydration. Decreasing DNA hydration via lyophilisation or by replacement of water with ethanol in solution modifies its conformation from the B to the A form. The yields of single strand breaks (SSB) are found to be highly dependent on the amount of DNA in the A configuration. The damage also increases with the amount of GNPs bound to DNA. At a ratio of two GNPs for one plasmid in an 80%-ethanol, 20%-water solution, 50% of the initial supercoiled population is converted to SSB. Thus, close contact with GNPs causes extensive damage to DNA in the A form. Since during transcription the DNA-RNA duplexes adopt an A form, GNPs could be genotoxic. Our results suggest that GNPs may have potential as chemotherapeutic agents if conjugated to nuclear targeting ligands. Considering their additional radiotherapeutic properties, targeted GNPs could also become highly effective in the treatment of cancer with concomitant chemoradiation therapy.

A novel copper-catalysed oxidative cyclisation has been developed for the synthesis of trisubstituted oxazoles, which is thought to proceed through cascade formation of C-N and C-O bonds by oxygen oxidation. The desired products can be obtained from readily available starting materials while avoiding hazardous materials. Therefore, a green synthetic method for the preparation of oxazoles has been found.

No abstract