Succinate fermentation was investigated in Escherichia coli strains overexpressing Actinobacillus succinogenes phosphoenolpyruvate carboxykinase (PEPCK). In E. coli K-12, PEPCK overexpression had no effect on succinate fermentation. In contrast, in the phosphoenolpyruvate carboxylase mutant E. coli strain K-12 ppc::kan, PEPCK overexpression increased succinate production 6.5-fold.Succinate is a four-carbon dicarboxylic acid, which has many applications in agriculture, food, and pharmaceutical industries. It is also a potential intermediary commodity chemical feedstock derived from biomass. Succinate production from glucose involves reductive CO 2 fixation. Several enzymes involved in CO 2 fixation have been overexpressed in Escherichia coli to enhance succinate production. Succinate production was increased by overexpressing pyruvate carboxylase, phosphoenolpyruvate (PEP) carboxylase (PPC), and malic enzyme, whereas overexpression of E. coli PEP carboxykinase (PEPCK) had no effect (3,4,8,12,18). In this paper, we call PPC the enzyme that catalyzes the formation of oxaloacetate plus P i from PEP plus CO 2 (i.e., EC 4.1.1.38), and we call PEPCK the enzyme that catalyzes the formation of oxaloacetate plus ATP from PEP, ADP, and CO 2 (i.e., EC 4.1.1.49) (5). Actinobacillus succinogenes is a natural succinate producer (6, 7). In contrast to E. coli, PEPCK is the main CO 2 -fixing enzyme in the A. succinogenes succinate production pathway (17). We have cloned and sequenced the A. succinogenes pckA gene (P. Kim, M. Laivenieks, J. McKinlay, C. Vieille, and J. G. Zeikus, submitted for publication). In this report, we describe the effect of A. succinogenes PEPCK overexpression on succinate production in wild-type and ppc mutant E. coli strains.The characteristics of the E. coli strains used in this study are described in Table 1. The molecular biology techniques used in this study were performed as described previously (15). To construct a knockout K-12 ppc mutant, a ppc-5::kan gene was introduced into E. coli K-12 by P1 transduction with a P1 lysate of strain JCL1242 (Table 1) as described previously (13). E. coli DH5␣ was used as the host for the subcloning experiments. To clone the A. succinogenes pckA gene into an expression system, the A. succinogenes pckA gene (Kim et al., submitted) was amplified by using A. succinogenes chromosomal DNA as the template and oligonucleotides 5Ј-GCGAGAG TACTGACTTAAACAAACTCG (where the underlined sequence creates a ScaI site) and 5Ј-ACGCGTCGACCTCAGC CTTATTTTTCAG (where the underlined sequence creates a SalI site) as the forward and reverse primers, respectively. The 1.6-kb PCR product was cloned into pCRII (Invitrogen, Carlsbad, Calif.) and sequenced. The pckA gene was then subcloned into the EheI and SalI sites of expression vector pProEx-1 (Invitrogen), yielding plasmid pAsPCK. In this construct, PEPCK is expressed with an N-terminal His tag followed by a TEV protease cleavage site. Plasmid pAsPCK was used to overexpress A. succinogenes PEPCK in E. coli.Single colonies of E. coli cel...