Alternative splicing at position 3495 b yields SERCA2 (sarco/endoplasmic reticulum Ca2+ pump 2) RNA species, namely SERCA2a and SERCA2b which differ in 3'-end regions. This results in SERCA2b RNA being less stable. In vitro decay experiments show that, in the presence of protein extracts from nuclei of LVMs (left ventricular myocytes), the rate of decay of both SERCA2b RNA and synthetic RNA from its 3'-region is greater than that of the corresponding SERCA2a RNA. To search for cis-acting instability elements in the 3'-region of SERCA2b, we examined the effects of LVM nuclear protein extracts on the in vitro decay of six short overlapping capped [m7G(5')ppp(5')Gm] and polyadenylated (A40) RNA fragments from the 3'-end region (3444-4472) of SERCA2b. The proximal fragment 2B1 (3444-3753) was the most unstable. 2B1 RNA without a cap or a polyadenylated tail was analysed further in electrophoretic mobility-shift assays, and was observed to bind to protein(s) in the nuclear extracts. Based on competition for binding to nuclear proteins between radiolabelled 2B1 RNA and short unlabelled RNA fragments, the cis-acting element involved in this binding was the sequence 2B1-4. 2B1-4 is a 35-base (3521-3555, CCAGUCCUGCUCGUUGUGGGCGUGCACCGAGGGGG) GC-rich region just past the splice site (3495). Nuclear extracts decreased the electrophoretic mobility of the radiolabelled 2B1-4 RNA which bound to two proteins (19 and 21 kDa) in cross-linking experiments. Excess 2B1-4 RNA decreased the decay of the 2B1 RNA by the nuclear protein extract. 2B1-del 4 RNA (2B1 with the 2B1-4 domain deleted) also decayed more slowly than the control 2B1 RNA. Thus SERCA2b contains a novel GC-rich cis-acting element involved in its decay by nuclear proteins.
We engineered caloxin 1c2, a novel high affinity peptide (TAWSEVLDLLRRGGGSK‐amide) inhibitor of the Plasma Membrane Ca2+ pump (PMCA). To show that caloxin 1c2 acts by binding to the PMCA, we synthesized a photoreactive derivative 3Bpa‐caloxin 1c2 (TA(Bpa)SEVLDLLRRGGGSK‐biotin), containing the photoreactive residue Bpa (benzoylphenylalanine) and biotin. 3Bpa‐caloxin 1c2 inhibited the Ca2+‐Mg2+‐ATPase activity of PMCA. The human erythrocyte membranes were photolabeled with 3Bpa‐caloxin 1c2 and the proteins were detected in the Western blots using HRP‐streptavidin to identify biotin or PMCA antibodies to detect PMCA. The photolabeled erythrocyte membranes showed a 250–270 kDa doublet with HRP‐streptavidin. The degree of biotinylation of the erythrocyte membranes depended on the length of the cross‐linking time, and concentrations of 3Bpa‐caloxin 1c2 and the membrane protein. Immunoprecipitates from the photolabeled erythrocyte membranes using a PMCA antibody showed a 250–270 kDa doublet with HRP‐streptavidin. Biotinylated proteins isolated from the photolabeled erythrocyte membranes using captavidin also showed a 250–270 kDa doublet with HRP‐streptavidin and PMCA antibodies. Caloxin 1c2 had been selected for binding to the extracellular domain 1 (amino acids 115–131) of PMCA isoform 4. Caloxin 1c2 and the extracellular domain 1 peptide of PMCA 4 competed with 3Bpa‐caloxin 1c2 for photolabeling the erythrocyte membranes. Pieces of de‐endothelialized pig coronary artery cross‐linked to 3Bpa‐caloxin 1c2 and treated with Alexa‐streptavidin were examined by confocal microscopy, using the Na+‐pump inhibitor Bodipy‐ouabain as a positive control. Both the probes bound to the cell surface. Thus, the photoreactive derivative of caloxin 1c2 binds to PMCA at the cell surface.Supported by Heart & Stroke Foundation of Ontario.
scite is a Brooklyn-based organization that helps researchers better discover and understand research articles through Smart Citations–citations that display the context of the citation and describe whether the article provides supporting or contrasting evidence. scite is used by students and researchers from around the world and is funded in part by the National Science Foundation and the National Institute on Drug Abuse of the National Institutes of Health.