The mammalian oviduct is the place where life begins as it is the site of fertilization and preimplantation embryo development. Recent research has highlighted the important role played by the oviduct both in sperm selection for natural fertilization and in the genetic and epigenetic reprogramming of preimplantation embryo development. This review examines oviduct fluid composition with a special emphasis on exosomes and the role played by the oviduct in sperm selection, early embryo development, and in reshaping the epigenetic landscape of the embryo. In addition, the implications of data obtained for improving assisted reproductive technologies are discussed.

Knowledge of how the biochemical composition of the bovine oviduct is altered due to the oviduct anatomy or the presence of an embryo is lacking. Thus, the aim of this study was to assess the effect of (I) oviduct anatomy and (II) embryo presence on oviductal fluid (OF) protein, amino acid, and carbohydrate composition. Cross-bred beef heifers (n = 19) were synchronized and those in standing estrus were randomly allocated to a cyclic (non-bred) or pregnant (artificially inseminated) group. All heifers were slaughtered on Day 3 after estrus. The oviducts ipsilateral to the corpus luteum from each animal were isolated, straightened and cut, separating ampulla and isthmus. Each portion was flushed with 500 µl of PBS enabling recovery of the oocyte/embryo. Recovered unfertilized oocytes (cyclic group) and embryos (8-cell embryos; pregnant group) were located in the isthmus of the oviduct. Samples of flushing medium from the isthmus and ampulla were used for proteomic (n = 2 per group), amino acid (n = 5), and carbohydrate (n = 5) analysis. For proteomic analysis, total protein from cyclic and pregnant samples were labelled with different cyanine fluorescent probes and separated according to the isoelectric point using immobilized pH gradient strips (pH 3-10, 17 cm, Protean ® IEF cell system, Bio Rad). Second dimension was performed in a polyacrylamide gel (12%) in the presence of SDS using a Protean II XL system (Bio Rad). Images were obtained with a Typhoon 9410 scanner and analyzed with Progenesis SameSpots software v 4.0. Amino acid content in the OF was determined by high performance liquid chromatography (HPLC). Glucose, lactate, and pyruvate were quantified using microfluorometric enzyme-linked assays. For the proteomic assessment, the results of the image analysis were compared by ANOVA. For both amino acid and carbohydrate analyses, statistical analysis was carried out by 2-way ANOVA with the Holm-Sidak nonparametric post hoc analysis. On Day 3 post-estrus, OF composition varied based on (I) anatomical region, where isthmic metabolites were present in lower (i.e., lactate, glycine, and alanine) or higher (i.e., arginine) concentrations compared to the ampulla; and (II) embryo presence, which was correlated with greater, arginine, phosphoglycerate kinase 1, serum albumin, α-1-antiproteinase and IGL@ Int.The oviduct is a tubular seromuscular organ connecting the ovary to the uterus providing a physiological environment for gamete interaction, fertilization, and early embryo development. During the first four days of embryo development, which occurs within the oviduct [1], embryonic nutritional requirements are presumed to be fulfilled largely by oviduct fluid (OF)-a complex mixture of proteins, amino acids, carbohydrates, ions, hormones, and extracellular vesicles, amongst other constituents [2]. OF composition is regulated by (I) selective transudate from the vasculature, and (II) the secretory cells within the oviduct epithelial monolayer [3]. Moreover, OF composition is influenced spatially by the anatomical...

The oviduct undergoes changes under the influence of steroid hormones during the oestrous cycle. However, the molecular mechanisms underlying oviductal regulation are not fully understood. The aim of the present study was to identify the gene expression profile of the porcine oviduct in different stages of the cycle using microarray technology. A systematic study was performed on animals at four different stage: prepubertal gilts, and sows in the preovulatory, postovulatory and luteal phase of the oestrous cycle. The porcine oviduct expressed a total of 4929 genes. Moreover, significant differences in the expression of several genes were detected as the oestrous cycle progressed. Analysis of the differentially expressed genes indicated that a total of 86, 89 and 15 genes were upregulated in prepubertal gilts, preovulatory and luteal sows respectively compared with levels observed in postovulatory sows. Moreover, 80, 51 and 64 genes were downregulated in prepubertal, preovulatory and luteal animals respectively compared with the postovulatory sows. The concentrations of 10 selected transcripts were quantified by real-time reverse transcription-polymerase chain reaction to validate the cDNA array hybridisation data. Conversely, for some genes, localisation of corresponding protein expression in the oviduct was analysed by immunohistochemistry (i.e. cholecystokinin, glutathione peroxidase 2, mucin 1, phosphatidylethanolamine binding protein 4 and tachykinin 3) and mass spectrometry analysis of oviductal fluid allowed identification of peptides from all five proteins. The results of the present study demonstrate that gene expression in the porcine oviduct is clearly regulated during the oestrous cycle, with some oviductal proteins that could be related to several reproductive processes described here for the first time.

Killer-cell immunoglobulin-like receptors (KIR) are expressed by natural killer (NK) and effector T cells. Although KIR+ T cells accumulate in oncologic patients, their role in cancer immune response remains elusive. This study explored the role of KIR+CD8+ T cells in cancer immunosurveillance by analyzing their frequency at diagnosis in the blood of 249 patients (80 melanomas, 80 bladder cancers, and 89 ovarian cancers), their relationship with overall survival (OS) of patients, and their gene expression profiles. KIR2DL1+ CD8+ T cells expanded in the presence of HLA-C2-ligands in patients who survived, but it did not in patients who died. In contrast, presence of HLA-C1-ligands was associated with dose-dependent expansions of KIR2DL2/S2+ CD8+ T cells and with shorter OS. KIR interactions with their specific ligands profoundly impacted CD8+ T cell expression profiles, involving multiple signaling pathways, effector functions, the secretome, and consequently, the cellular microenvironment, which could impact their cancer immunosurveillance capacities. KIR2DL1/S1+ CD8+ T cells showed a gene expression signature related to efficient tumor immunosurveillance, whereas KIR2DL2/L3/S2+CD8+ T cells showed transcriptomic profiles related to suppressive anti-tumor responses. These results could be the basis for the discovery of new therapeutic targets so that the outcome of patients with cancer can be improved.

Apolipoprotein B (APOB) has been described as the primary apolipoprotein component of low-density lipoproteins (LDL) and is absolutely required for its formation. However, other functions related with the male reproductive process may be attributed to this protein. In mouse, expression of the Apob gene has been described in the testis and epididymis. Moreover, male mice heterozygous for a targeted mutation of the Apob gene exhibit severely compromised fertility. However, the relation between this protein and the fertilization process remain to be investigated. The objective of this study was to determine whether APOB mRNA is expressed in the porcine oviduct and to analyse its expression during the different phases of the oestrus cycle. Oviducts were obtained from sows slaughtered at a local abattoir and were classified based on follicular morphology: prepuber (containing only follicles 1 to 2 mm in diameter), preovulatory (containing 6 to 12 follicles 8 to 12 mm in diameter), post-ovulatory (containing 6 to 12 hemorrhagic corpora), and luteal phase (containing 6 to 12 corpora lutea). Total RNA was extracted from scraps of isthmus-ampullar junction mucosa using RNAqueous® kit (Ambion, Austin, TX, USA) according to the manufacturer’s instructions, and cDNA was synthesised with an oligo (dT) as primer. This cDNA was used as template in RT-PCR amplifications and qPCR using specific primers designed based on GenBank sequence for Sus scrofa APOB (L11235; Fw: caacaactcaaggcccagat, Rv: ctgaattttgccgttgattc for RT-PCR and Fw: tggccagagctgtccaaggga and Rv: ccactggagctctcagcct for qPCR). The amplification by RT-PCR resulted in a 567-bp amplicon. The sequencing of this PCR product has shown a high similarity with APOB sequences of different mammalian species. On the other hand, analysis by quantitative PCR did not reveal any differences in the expression of APOB between the samples of various stages of the oestrus cycle. In conclusion, the APOB mRNA is present in the porcine oviduct and its level of expression is similar in different phases of the cycle. The role played by this protein in the oviduct remains to be clarified. This study was supported by MICINN (AGL2009-12512-C02-01-02).

Polyspermy is an important anomaly of fertilization and is responsible for the low efficiency of IVF in the porcine species. It was reported that the exposure of oocytes to oviducal fluid increases monospermy after IVF in pigs. This fact has been related with the binding of OVGP1 to the ZP and is affected by heparin glycosaminoglycan. The OVGP1 is removed from the ZP during the embryo transit towards the uterus; however, the mechanism responsible for this process is unknown. Taking into account the contribution of the heparin in this process, the presence of heparanase in the oviduct milieu was postulated. This enzyme could degrade the heparin and unstabilised the binding of the OVGP1 to ZP. The aim of this study was to describe the presence of mRNA codifying for heparanase in the porcine oviduct. Oviducts from 4 animals in preovulatory phase were obtained. Epithelial cells from the oviducal mucosa (ampulla) was obtained by scraping, and total RNA was isolated using the RNAqueous® kit (Ambion, Austin, TX, USA) according to the manufacturer’s instructions. Complementary DNA was synthesised with an oligo dT as primer. This cDNA was used as the template in RT-PCR amplifications using specific primers designed based on GenBank sequence for Sus scrofa heparanase (NM_001146130.2). The amplification by RT-PCR resulted in a 199-bp amplicon. This PCR product was automatically sequenced and showed a high similarity with heparanase of different mammalian species. In conclusion, the heparanase mRNA is present in the porcine oviduct. This glycosidase could participate in the regulation of heparin content in the oviducal milieu. More studies are necessary to clarify its effect in the oviducal fluid and fertilization. This study was supported by MICINN (AGL2009-12512-C02-01-02).

The haptoglobin is an acute phase protein that has been recently related with numerous events of mammalian reproduction. The objective of this study was to determine whether haptoglobin mRNA is expressed in the porcine oviduct and to analyse its expression during the different phases of the oestrus cycle. Porcine oviducts collected from a local abattoir were classified based on follicular morphology: prepuberal (containing only follicles 1 to 2 mm in diameter), preovulatory (containing 6 to 12 follicles 8 to 12 mm in diameter), post-ovulatory (containing 6 to 12 hemorrhagic corpora), and luteal phase (containing 6 to 12 corpora lutea). Total RNA was obtained by extracting scraps of isthmus-ampullar junction mucosa using RNAqueous® kit (Ambion, Austin, TX, USA) according to the manufacturer’s instructions and cDNA was synthesised with an oligo d(T) as primer. This cDNA was used as template in RT-PCR and quantitative PCR (qPCR) amplifications using specific primers (Fw: gctacgtggagcacatggtt and Rv: ggagattcttagccgtggtc for RT-PCR and Fw: ggtgatgcccatttgcctccct and Rv: cagccaccggcagcatgaca for qPCR) designed based on GenBank sequence for Sus scrofa haptoglobin (NM_214000). The amplification by RT-PCR resulted in a 312-bp amplicon. This PCR product was sequenced and a 100% of identity with porcine haptoglobin sequence deposited in GenBank database was confirmed. On the other hand, analysis by qPCR revealed that the haptoglobin mRNA expression was more elevated in luteal and post-ovulatory phases than in prepuber and preovulatory phases. In conclusion, the haptoglobin mRNA is present in porcine oviduct and could be considered as a progesterone-dependent transcript. The role played by this protein in the porcine oviduct remains to be investigated. This study was supported by MICINN (AGL2009-12512-C02-01-02).

It has been shown that the equine embryo is able to modulate the proteome of the oviduct, increasing the presence of certain proteins involved in the embryo-maternal communication (Smits et al. 2016 Reprod. Fertil. Dev. doi: 10.1071/RD15481). In cattle, the presence of a single embryo did not affect the transcriptome of the oviduct, whereas multiple embryos induced changes (Maillo et al. 2015 Biol. Reprod. 92, 144). The aim of the present study was to examine the effect of the presence of an embryo on the oviduct fluid proteome. Cross-bred beef heifers were synchronized, and those in standing oestrus were randomly allocated to cyclic, not bred (n = 7), or pregnant, artificially inseminated (n = 11), groups. All heifers were slaughtered on Day 3 after oestrus. The oviducts from each animal were isolated, straightened, and cut, separating ampulla and isthmus. Each portion was flushed with 500 μL of PBS free of protein to confirm the presence of an oocyte/embryo. Recovered unfertilized oocytes (cyclic group) and embryos (pregnant group) were located in the isthmus of the oviduct ipsilateral to the corpus luteum. Flushings from 4 cyclic and 4 pregnant heifers (8-cell embryos) were used for proteomic analysis, including blank controls of PBS. Comparison of ipsilateral ampulla and isthmus in pregnant and cyclic heifers did not reveal any differences. Therefore, samples from ipsilateral oviducts were compared between cyclic and pregnant heifers. Total protein (150 μg) from cyclic and pregnant samples was labelled with different cyanine fluorescent probes and separated according to the isoelectric point using immobilized pH gradient strips (pH 3–10, 17 cm, Protean® IEF cell system, Bio Rad, Hercules, CA, USA). Second dimension was performed in a polyacrylamide gel (12%) in the presence of SDS using a Protean II XL system (Bio Rad). The images were obtained with the Typhoon 9410 scanner and analysed with the Progenesis SameSpots software v. 4.0. The results of image analysis showed 42 different spots between the 2 groups (ANOVA P < 0.01 and fold difference >1.5), the majority (38) of which were more abundant in pregnant heifers. Gels were stained with Coomassie blue to detect the spots. The differential spots were digested with trypsin and analysed with Agilent Ion-Trap XCT Plus mass spectrometer (Agilent Technologies, Santa Clara, CA, USA) equipped with an electrospray interface. Twenty spots were highly abundant in pregnant heifers. From these, 3 different proteins were identified with score >5.0 and % SPI >76.0 by mass spectrometry, corresponding to SERPINA1, serum albumin, and serum transferrin. These proteins are abundant in plasma, suggesting that the embryo may be able to activate pathways to increase the permeability of the vascular endothelium in the oviduct. The same proteins were also identified in the equine oviducal proteome in the presence of an embryo, suggesting a possible conserved mechanism between species. In conclusion, presence of an embryo in the bovine oviduct increases the abundance of some proteins that may be related with its early development. This work was funded by the Spanish Ministry of Economy and Competitiveness (AGL-2012–37510 and AGL-2015–70140-R) and Science Foundation Ireland (13/IA/1983).