Root-knot nematodes (Meloidogyne spp.) are important contributors to yield reduction in tomato. Though resistant cultivars to common species (Meloidogyne arenaria, M. incognita, and M. javanica) are available, they are not effective against other major species of root-knot nematodes. Cultivars or lines of Solanum sisymbriifolium were examined to assess the presence and level of resistance to five major species: M. arenaria race 1, M. incognita race 3, M. haplanaria, M. javanica, and M. enterolobii. Differences in S. sisymbriifolium response to the nematode infection were apparent when susceptibility or resistance was classified by the egg counts per gram fresh weight of root and the multiplication rate of the nematodes. The cultivar Diamond was highly susceptible, Quattro and White Star were susceptible, while Sis Syn II was resistant to M. arenaria. Quattro, White Star, and Sis Syn II exhibited a moderate to high level of resistance to M. incognita but the nematode increased 2.5-fold from the initial population of the M. incognita on Diamond. All S. sisymbriifolium cultivars were highly resistant to both M. haplanaria and M. enterolobii, while highly susceptible to M. javanica. A microplot study under field conditions using Sis Syn II confirmed that M. arenaria, M. incognita, and M. haplanaria were not pathogenic on the plant. Likewise, an examination on cross-sections of galled root tissues confirmed the susceptibility and resistance of S. sisymbriifolium lines to Meloidogyne spp. Using S. sisymbriifolium as a resistant rootstock or a new source of resistance may result in the development of nonchemical and sustainable management strategies to protect the tomato crop.
Meloidogyne incognita, the southern root-knot nematode (RKN), is the most predominant plant-parasitic nematode species of tomato and causes significant yield loss. The Mi-1.2 gene confers resistance in tomatoes to M. incognita; however, virulent RKN populations capable of parasitizing resistant tomato cultivars have been reported from different regions in the world. Four naturally occurring virulent populations of M. incognita were found in vegetable fields from four counties in Georgia with no history of tomato cultivation of the Mi gene. Two consecutive greenhouse trials showed that all four virulent RKN populations reproduced on tomato cultivars, including Amelia, Skyway, and Myrtle, with the Mi-1 gene, while an avirulent population of M. incognita race 3 was unable to overcome host resistance. Virulent RKN populations varied in reproduction among resistant cultivars, with Ma6 population having the greatest reproduction potential. No difference in penetration potential of the virulent (Ma6) and avirulent populations was found on susceptible and resistant tomato cultivars. However, virulent Ma6 population females were successful at egg-laying, whereas avirulent female development was arrested in the resistant cultivars. The virulent Ma6 population also induced feeding sites in the roots of resistant cultivars, whereas the avirulent population did not. To our knowledge, this is the first report of resistance-breaking populations of M. incognita in Georgia and the second state in the United States after California.
Onions (Allium cepa L.) are the leading vegetable crop in Georgia accounting for 13.7% of total state vegetable production (Wolfe and Stubbs, 2017). In November 2017, two samples each of onion (var. Candy Ann) seedlings and soil were received from the University of Georgia Cooperative Extension office in Tattnall County, GA. The samples were collected from a nursery fumigated with metam sodium and used for sweet onion transplant production. Symptoms of the damaged plants included stunted growth both in the root system and foliage, tip die-back of the leaves (Fig. 1A,B), and slight swelling at the tip of roots. Vermiform life stages from the soil samples were extracted using centrifugal-flotation technique (Jenkins, 1964). On an average, 67 stubby-root nematodes per 100 cm 3 of soil were obtained. Additional two soil samples were collected from the nursery in December 2017 to confirm the presence of the nematode. On an average, 1 and 75 nematodes per 100 cm 3 of soil were recovered from areas with healthy and infested plants, respectively. Because the male individuals were not found in the soil samples, females were used for species identification. Morphological and molecular analyses of females (Fig. 2A-C) identified the species as Paratrichodorus minor (Colbran) Siddiqi; (Decraemer, 1995). Nematode body shape was "cigar-shaped" with dorsally curved "onchiostyle" stylet Females had an oval-shaped vagina, vulva a transverse slit, and lateral body pores were absent. The measurements of females (n = 20) included: body length 671.1 (570.1-785.3) µm; body width 32.5 (27.8-37.0) µm; onchiostyle 32.5 (31.1-34.8) µm; anterior end to esophagus-intestinal valve 117.6 (101.2-128.5) µm; a 21.5 (15.3-28.1) µm; b 5.2 (4.9-6.3) µm; V 52.9% (48.1-55.4%) µm; and vagina length 8.7 (7.8-10.7) µm. To confirm the identity of P. minor, DNA was extracted from single females (n = 3) using Extract-N-Amp ™ Tissue PCR Kit (Sigma-Alredich Inc., St. Louis, MO). The partial 18S rRNA, the D2-D3 expansion segments of 28S rRNA, and ITS1 rDNA were amplified using primer pairs 360F (5¢ CTACCACATCCAAGGAAGGC 3¢)/932R (5¢ TATCTGATCGCTGTCGAACC 3¢), D2A (5¢ ACAAG TACCGTGAGGGAAAGTTG 3¢)/D3B (5¢ TCGGAAGGAACCAGCTAC TA 3¢), and BL18 (5¢ CCCGTCGCTACTACCGATT 3¢)/5818 (5¢ ACGARCCGAGTGATCCAC 3¢), respectively (
Oilseed radish and oat are cool season annual crops that are potentially used as "trap" or "biofumigant" crops for the suppression of plantparasitic nematodes in soil. Cultivars of oilseed radish (Carwoodi, Cardinal, Final, Image, Concorde, Control, Eco-Till, Karakter and Cannavaro), white (Tachiibuki) and black (Pratex) oats were evaluated for their ability to reduce reproduction of three root-knot nematode species: Meloidogyne javanica, M. incognita race 3, and M. arenaria race 1. Nematode penetration and development were also evaluated using selected resistant and susceptible cultivars under greenhouse conditions. Root galling severity, number of eggs per gram of fresh root, and rate of reproduction varied among the cultivars in response to nematode infection. Oilseed radish cv. Carwoodi was resistant to M. javanica, whereas Karakter and Concorde were maintenance hosts allowing the nematode to maintain or increase its population on the plants. For M. incognita, Control and Carwoodi oilseed radish and Tachiibuki oat were resistant hosts. The cultivars that supported little reproduction of M. arenaria were Karakter and Carwoodi radish, and Tachiibuki oat. Comparable numbers of nematodes entered the roots of susceptible and resistant cultivars of oilseed radish and oat during early stages of infection. However, the development of the nematodes as evident from counting young and egg-laying females in roots were significantly decreased or inhibited in the resistant cultivars compared to the susceptible cultivars indicating that resistance occurs at post-infection stages. Histopathological examinations of galled-root tissues also revealed the susceptibility and resistance responses of selected cultivars of oilseed radish and oat to these nematode species.
scite is a Brooklyn-based organization that helps researchers better discover and understand research articles through Smart Citations–citations that display the context of the citation and describe whether the article provides supporting or contrasting evidence. scite is used by students and researchers from around the world and is funded in part by the National Science Foundation and the National Institute on Drug Abuse of the National Institutes of Health.
hi@scite.ai
10624 S. Eastern Ave., Ste. A-614
Henderson, NV 89052, USA
Copyright © 2024 scite LLC. All rights reserved.
Made with 💙 for researchers
Part of the Research Solutions Family.