Fifty four genotypes including four checks were grown in a RBD with three replications during Rabi 2010-11 at Vegetable Experimental Research Farm, Nauni, Solan HP to estimate the parameters of variability and association of important characters with yield in garden pea. Analysis of variance showed significant differences among the genotypes for all the morphological characters under study. The genotypic and phenotypic coefficients of variation were high for total soluble solids, total sugars, pod yield per hectare and total phenols. High heritability estimates coupled with high to moderate genetic gain observed for pod yield (kg/plot), node at which the first flower appear (number), number of pods per plant and total Phenols (g/100g). Pod yield was positively correlated with number of pods per plant, pod length (cm), number of seeds per pod and shelling percentage thereby indicating that the selection based on these traits could be effective for improvement of green shelled peas yield.

Crucifers are popular temperate vegetables and occupy important place among vegetables in India as well as in the world. India is the second largest producer of crucifers in the world. These crops are affected by many diseases during the growing period which reduce the yield as well as the quality of the produce. Amongst all the diseases, black rot caused by Xanthomonas campestris pv. eampestrls (Pam.) Dowson is the most destructive one causing heavy losses. The disease affects primarily above ground parts of the plant at any stage of growth and causes high losses, in yield and quality especially in tropical and subtropical regions during the rainy season. All vegetables in the cruciferous family, including broccoli, brussels sprouts, cabbage, cauliflower, Chinese cabbage, kale, mustard, radish, rutabaga, and turnip are susceptible to black rot. Many cruciferous weeds such as Shepherd's Purse, wild mustard, and yellow rocket are also known to be hosts of this pathogen. The pathogen is seed borne and also survives in the infected plant debris as well as cruciferous weed hosts. The disease can be managed through cultural practices, resistant hosts, seed treatment with hot water and antibiotics, fungicides, biological control as well as chemical control methods.

The bioagents like Plant Growth Promoting Rhizobacteria (PGPR) and Biocontrol Agents (BCAs) play a crucial role in plant growth promotion, nutrient uptake and suppression of biotic and abiotic stresses. Different researchers have applied these bioagents by various means either through seed treatment or through soil application to prevent various plant diseases. Thus, these non-chemical environment friendly tools can be exploited to enhance crop production.

The effect of seed biopriming with different bioagents including plant growth promoting rhizobacteria (PGPR-1), rhizobial biofertilizer (Rhizobium strain B1) and biological control agent (Trichoderma viride) was observed on plant growth, seed yield and incidence of diseases in French bean cv. Contender conducting a field experiment during kharif season in the year 2017 and 2018. Under field conditions in both the years, field emergence (95.18 %), plant height at 30 days after sowing (34.09 cm), plant height at final harvest (56.99 cm), days to pod harvest (52.33), harvest duration (18.67), pod length at final harvest (16.83 cm), number of pods per plant (20.17), dry pod weight (2.72 g), pod yield per plant (38.64 g), number of seeds per pod (7.17), seed yield per plant (20.76 g), seed yield per plot (875.33 g), seed yield per hectare (23.34 q), 100 seed weight (34.19 g), quality of harvested seeds were recorded significantly higher after seed biopriming with PGPR-1+ Rhizobium strain B1 (T4) as compared to carbendazim seed treatment and untreated control. This treatment combination also reduced the incidence of major diseases like, Rhizoctonia root rot and Angular leaf spot significantly as compared to carbendazim seed treatments and untreated control. It can be concluded from the present investigation that seed biopriming of French bean cv. Contender with PGPR-1+Rhizobium strain B1 @ 109cfu/ml for 8 hours was an effective treatment which significantly improved plant growth, pod yield, seed yield, seed quality and seed vigour and reduced disease incidence as compared to seed treatment with carbendazim @ 0.2% as well as untreated control under field conditions.

An investigation was carried out during

In present day agriculture, use of chemicals for crop production is discouraged. Hence, other alternative treatments for disease control must be developed, and hot water treatment is one of them. It is a feasible practice, both financially and time wise. Hot water soaking is a very age-old practice, efficient in destroying pathogens borne both outside the testa and inside the seed testa by using temperature hot enough to kill the organism but not quite hot enough to kill the seed. Extensive research work has been reported on hot water treatment in vegetables. Therefore, an attempt has been made to review the information available regarding the effect of hot water treatment on growth, disease incidence and yield of vegetables.

No abstract

A new disease was observed during the early spring of 2011 and 2012 on coriander (Coriandrum sativum L.) in the Himachal Pradesh state of India. Disease incidence was estimated as 10% in approximately 5 ha. Symptoms were observed as brown leaf spots (1 to 2 × 3 to 5 mm) surrounded by a water soaked area. The leaf spots were often angular, being limited by veins. Leaf spots merged to cause a more extensive blight. Symptomatic leaf tissues were surface sterilized in 0.1% HgCl2 for 30 sec followed by three successive rinses in sterilized water. Small sections of tissue were excised aseptically from leaf spot margins and transferred to several drops of sterile distilled water in a petri dish for 30 min. The diffusate was streaked onto King's B medium and incubated at 25°C for 24 to 48 h. Six representative strains of bacteria were isolated from five infected leaves. The bacteria were characterized as Gram negative, rod shaped, with few polar flagella and nonfluorescent on KB, and positive for levan production and tobacco hypersensitivity reaction but negative for oxidase reaction, rot of potato slices, and arginine dihydrolase. Preliminary identification of bacterial isolates was made on the basis of morphological and biochemical characters (3) and confirmed for one isolate by partial 16S rRNA gene sequencing. Using primers PF:5′AACTGAAGAGTTTGATCCTGGCTC3′ and PR:5′TACGGTTACCTTGTTACGACTT3′, a 1,265-bp DNA fragment of the 16S rDNA region was amplified. A BLAST search of this sequence (JX 156334) in the NCBI database placed the isolate in the genus Pseudomonas, with 99% similarity to accession P. syringae GRFHYTP52 (GQ160904). The sequence also showed 97% similarity to P. syringae pv. apii and P. syringae pv. coriandricola isolates from California (1). Identification of the bacterium to pathovar was based on host symptoms, fulfillment of Koch's postulates, cultural characteristics, physiological and determinative tests, and specificity of host range (2). Host range studies were conducted on celery, carrot, fennel, parsley, and parsnip, and no symptoms developed on any of these hosts. Pathogenicity was confirmed by artificial inoculation of five 1-month-old coriander plants with all isolates. A bacterial suspension (108 CFU ml–1) was injected into four leaves for each isolate with a hypodermic syringe and inoculated plants were placed in growth chamber at 25°C and 80% relative humidity. Initial symptoms were observed on leaves within 5 days of inoculation. No symptoms were observed on control plants inoculated with sterile water. Reisolation was performed on dark brown lesions surrounded by yellow haloes on the inoculated leaves and the identity of isolated bacteria was confirmed using the biochemical, pathogenicity, and molecular techniques stated above. All tests were performed three times. To our knowledge, this is the first report of P. syringae pv. coriandricola causing leaf spot disease on coriander in India. References: (1) Bull et al., Phytopathology 101:847, 2011. (2) Cerkauskas, Can. J. Plant Pathol. 31:16, 2009. (3) R. A. Lelliott and D. E. Stead, Methods for the Diagnosis of Bacterial Diseases of Plants, Blackwell Scientific, Sussex, UK, 1988.