We have identified a previously undescribed intrinsic cardiac adrenergic (ICA) cell type in rodent and human heart. Northern and Western blot analyses demonstrated that ICA cell isolates contain mRNA and protein of enzymes involved in catecholamine biosynthesis. Radioenzymatic catecholamine assays also revealed that the catecholamine profile of adult rat ICA cell isolates differed from that of sympathetic neurons. Unlike sympathetic neuronal cells, isolated ICA cells have abundant clear vesicles on electron microscopy. Endogenous norepinephrine and epinephrine constitutively released by ICA cells in vitro affect the spontaneous beating rate of neonatal rat cardiac myocytes in culture. Finally, ICA cells could be identified in human fetal hearts at a developmental stage before sympathetic innervation of the heart has been documented to occur. These findings support the concept that these cells constitute an ICA signaling system capable of participating in cardiac regulation that appears to be independent of sympathetic innervation. ( J. Clin. Invest. 1996. 98:1298-1303.)

BackgroundChronic gastritis is one of the most common findings at upper endoscopy in the general population, and chronic atrophic gastritis is epidemiologically associated with the occurrence of gastric cancer. However, the current status of diagnosis and treatment of chronic gastritis in China is unclear.MethodsA multi-center national study was performed; all patients who underwent diagnostic upper endoscopy for evaluation of gastrointestinal symptoms from 33 centers were enrolled. Data including sex, age, symptoms and endoscopic findings were prospectively recorded.ResultsTotally 8892 patients were included. At endoscopy, 4389, 3760 and 1573 patients were diagnosed to have superficial gastritis, erosive gastritis, and atrophic gastritis, respectively. After pathologic examination, it is found that atrophic gastritis, intestinal metaplasia and dysplasia were prevalent, which accounted for 25.8%, 23.6% and 7.3% of this patient population. Endoscopic features were useful for predicting pathologic atrophy (PLR = 4.78), but it was not useful for predicting erosive gastritis. Mucosal-protective agents and PPI were most commonly used medications for chronic gastritis.ConclusionsThe present study suggests non-atrophic gastritis is the most common endoscopic finding in Chinese patients with upper GI symptoms. Precancerous lesions, including atrophy, intestinal metaplasia and dysplasia are prevalent in Chinese patients with chronic gastritis, and endoscopic features are useful for predicting pathologic atrophy.

With heart failure leading the cause of death in the USA (Hunt), biomedical research is fundamental to advance medical treatments for cardiovascular diseases. Animal models that mimic human cardiac disease, such as myocardial infarction (MI) and ischemia-reperfusion (IR) that induces heart failure as well as pressure-overload (transverse aortic constriction) that induces cardiac hypertrophy and heart failure (Goldman and Tarnavski), are useful models to study cardiovascular disease. In particular, myocardial ischemia (MI) is a leading cause for cardiovascular morbidity and mortality despite controlling certain risk factors such as arteriosclerosis and treatments via surgical intervention (Thygesen). Furthermore, an acute loss of the myocardium following myocardial ischemia (MI) results in increased loading conditions that induces ventricular remodeling of the infarcted border zone and the remote non-infarcted myocardium. Myocyte apoptosis, necrosis and the resultant increased hemodynamic load activate multiple biochemical intracellular signaling that initiates LV dilatation, hypertrophy, ventricular shape distortion, and collagen scar formation. This pathological remodeling and failure to normalize the increased wall stresses results in progressive dilatation, recruitment of the border zone myocardium into the scar, and eventually deterioration in myocardial contractile function (i.e. heart failure). The progression of LV dysfunction and heart failure in rats is similar to that observed in patients who sustain a large myocardial infarction, survive and subsequently develops heart failure (Goldman). The acute myocardial infarction (AMI) model in rats has been used to mimic human cardiovascular disease; specifically used to study cardiac signaling mechanisms associated with heart failure as well as to assess the contribution of therapeutic strategies for the treatment of heart failure. The method described in this report is the rat model of acute myocardial infarction (AMI). This model is also referred to as an acute ischemic cardiomyopathy or ischemia followed by reperfusion (IR); which is induced by an acute 30-minute period of ischemia by ligation of the left anterior descending artery (LAD) followed by reperfusion of the tissue by releasing the LAD ligation (Vasilyev and McConnell). This protocol will focus on assessment of the infarct size and the area-at-risk (AAR) by Evan's blue dye and triphenyl tetrazolium chloride (TTC) following 4-hours of reperfusion; additional comments toward the evaluation of cardiac function and remodeling by modifying the duration of reperfusion, is also presented. Overall, this AMI rat animal model is useful for studying the consequence of a myocardial infarction on cardiac pathophysiological and physiological function. 2. All surgical instruments are to be sterilized with a hot bead sterilizer before surgery (and in between individual rat surgeries). These instruments include: surgical scissors (2), forceps (1), curved forceps (1), needle holder (2), and a chest rectract...

During the past years, there has been a global outbreak of allergic diseases, presenting a considerable medical and socioeconomical burden. A large fraction of allergic diseases is characterized by a type 2 immune response involving Th2 cells, type 2 innate lymphoid cells, eosinophils, mast cells, and M2 macrophages. Biomarkers are valuable parameters for precision medicine as they provide information on the disease endotypes, clusters, precision diagnoses, identification of therapeutic targets, and monitoring of treatment efficacies. The availability of powerful omics technologies, How to cite this article: Ogulur I, Pat Y, Ardicli O, et al. Advances and highlights in biomarkers of allergic diseases.

Intrinsic cardiac adrenergic (ICA) cells in developing rat heart constitute a novel adrenergic signaling system involved in cardiac regulation. Regulatory mechanisms of ICA cells remain to be defined. Immunohistochemical study of fetal rat hearts demonstrated ICA cells with catecholamine biosynthetic enzyme tyrosine hydroxylase (TH) and phenylethanolamine N-methyltransferase (PNMT). The mRNA of TH and PNMP was also detected in fetal rat hearts before sympathetic innervation. Immunoreactivity of norepinephrine transporter (NET) was localized to ICA cells in rat heart tissue and primary cell culture. calcium; hypoxia/reoxygenation; intrinsic cardiac adrenergic cells; myocytes; norepinephrine THE IMPORTANCE OF CATECHOLAMINES in augmenting heart function is well established. Catecholamines are obligatory for heart development. Animals with targeted disruption of catecholamine synthetic genes die in utero because of heart failure at an embryonic stage before sympathetic innervation (27). Although it has been proposed that the intrinsic cardiac nervous system contains adrenergic neurons involved in adult cardiac regulation (2), their role in fetal heart development is unknown. Huang et al. (14) identified, and it has been confirmed (8), that specialized nonneuronal cardiocytes, designated as intrinsic cardiac adrenergic (ICA) cells, possess catecholamine biosynthetic enzymes. ICA cells have been linked to fetal development, cardiac pacemaking and conduction, and blood pressure regulation (1,8,14,23,25). Recently, our laboratory (13) ] i transients of ICA cells are regulated by hypoxia/reoxygenation, an important biological stressor associated with adrenergic stimulation; 4) demonstration of norepinephrine transporters (NET) in ICA cells that constitutively take up and release norepinephrine; and 5) determination of whether catecholamines derived from ICA cells are essential for maintaining optimal pacemaking and myocyte contractile function. This study advances our understanding of cardiac neurohormonal regulation in normal and diseased states. MATERIALS AND METHODSAdrenergic gene expression in the fetal heart. The mRNA from fetal rat hearts at embryonic day 16 (E16) and from maternal adrenal glands was extracted following the TRIzol reagent manufacturer's instructions. The cDNA was reverse transcribed with primers AACTCTCCACGGTGTACTGGTT (sense) and GCATAGTTCCT-GAGCTTGTCCT (antisense) for tyrosine hydroxylase (TH) and ACTGGAGTGTGTATAG-CCAGCA (sense) and ACACTGGAAC-CACAGATAGCCT (antisense) for phenylethanolamine N-methyltransferase (PNMT) (Integrated DNA Technologies).Immunohistochemical studies. To identify ICA cells in myocardial tissue, immunohistochemical labeling was performed on 3-m paraffin sections of 4% formaldehyde-fixed fetal hearts (E16). The immunohistochemical methods for identifying ICA cells were described previously (14). The primary antibodies against TH and PNMT do not cross-react with other enzymes involved in the catecholamine biosynthetic cascade (14). The cell membranes were permeabilized with 0...