Clathrin-mediated endocytosis, the main trafficking route from the plasma membrane to the cytoplasm, is critical to many fundamental cellular processes. Clathrin, coupled to the membrane by adaptor proteins, is thought to play a major structural role in endocytosis by self-assembling into a cage-like lattice around the forming vesicle. Although clathrin adaptors are essential for endocytosis, little is known about their structural role in this process. Here we show that the membrane-binding domains of two conserved clathrin adaptors, Sla2 and Ent1, co-assemble in a PI(4,5)P2-dependent manner to form organized lattices on membranes. We determined the structure of the co-assembled lattice by electron cryo-microscopy and designed mutations that specifically impair the lattice formation in vitro. We show that these mutations block endocytosis in vivo. We suggest that clathrin adaptors not only link the polymerized clathrin to the membrane but also form an oligomeric structure, which is essential for membrane remodeling during endocytosis.

SummaryThe SOS response comprises a set of cellular functions aimed at preserving bacterial cell viability in front of DNA injuries. The SOS network, negatively regulated by the LexA protein, is found in many bacterial species that have not suffered major reductions in their gene contents, but presents distinctly divergent LexA-binding sites across the Bacteria domain. In this article, we report the identification and characterization of an imported multiple gene cassette in the Gamma Proteobacterium Pseudomonas putida that encodes a LexA protein, an inhibitor of cell division (SulA), an error-prone polymerase (DinP) and the alpha subunit of DNA polymerase III (DnaE). We also demonstrate that these genes constitute a DNA damage-inducible operon that is regulated by its own encoded LexA protein, and we establish that the latter is a direct derivative of the Gram-positive LexA protein. In addition, in silico analyses reveal that this multiple gene cassette is also present in many Proteobacteria families, and that both its gene content and LexA-binding sequence have evolved over time, ultimately giving rise to the lexA lineage of extant Gamma Proteobacteria.

In contrast to the vast majority of the members of the domain Bacteria, several Pseudomonas and Xanthomonas species have two lexA genes, whose products have been shown to recognize different LexA binding motifs, making them an interesting target for studying the interplay between cohabiting LexA regulons in a single species. Here we report an analysis of the genetic composition of the two LexA regulons of Pseudomonas putida KT2440 performed with a genomic microarray. The data obtained indicate that one of the two LexA proteins (LexA1) seems to be in control of the conventional Escherichia coli-like SOS response, while the other LexA protein (LexA2) regulates only its own transcriptional unit, which includes the imuA, imuB, and dnaE2 genes, and a gene (PP_3901) from a resident P. putida prophage. Furthermore, PP_3901 is also regulated by LexA1 and is required for DNA damage-mediated induction of several P. putida resident prophage genes. In silico searches suggested that this marked asymmetry in regulon contents also occurs in other Pseudomonas species with two lexA genes, and the implications of this asymmetry in the evolution of the SOS network are discussed.

Little is known about the regulation of the DNA damage-mediated gene expression in archaea. Here we report that the addition of actinomycin D to Sulfolobus solfataricus cultures triggers the expression of the radA paralogue sso0777. Furthermore, a specific retarded band is observed when electrophoretic mobility shift assays (EMSAs) with crude S. solfataricus cell extracts and the sso0777 promoter were carried out. The protein that binds to this promoter was isolated and identified as Sta1. Footprinting experiments have shown that the Sta1 DNA-binding site is included in the ATTTTTTATTTTCACATGTAAGATGTTTATT sequence, which is located upstream the putative TTG translation starting codon of the sso0777 gene. Additionally, gel electrophoretic mobility retardation experiments using mutant sso0777 promoter derivatives show the presence of three essential motifs (TTATT, CANGNA and TTATT) that are absolutely required for Sta1 DNA binding. Finally, in vitro transcription experiments confirm that Sta1 functions as an activator for sso0777 gene expression being the first identified archaeal regulatory protein associated with the DNA damage-mediated induction of gene expression.