Clostridium botulinum is a heterogeneous Gram-positive species that comprises four genetically and physiologically distinct groups of bacteria that share the ability to produce botulinum neurotoxin, the most poisonous toxin known to man, and the causative agent of botulism, a severe disease of humans and animals. We report here the complete genome sequence of a representative of Group I (proteolytic) C. botulinum (strain Hall A, ATCC 3502). The genome consists of a chromosome (3,886,916 bp) and a plasmid (16,344 bp), which carry 3650 and 19 predicted genes, respectively. Consistent with the proteolytic phenotype of this strain, the genome harbors a large number of genes encoding secreted proteases and enzymes involved in uptake and metabolism of amino acids. The genome also reveals a hitherto unknown ability of C. botulinum to degrade chitin. There is a significant lack of recently acquired DNA, indicating a stable genomic content, in strong contrast to the fluid genome of Clostridium difficile, which can form longer-term relationships with its host. Overall, the genome indicates that C. botulinum is adapted to a saprophytic lifestyle both in soil and aquatic environments. This pathogen relies on its toxin to rapidly kill a wide range of prey species, and to gain access to nutrient sources, it releases a large number of extracellular enzymes to soften and destroy rotting or decayed tissues.

Bacterial endospores are among the most resilient forms of life on earth and are intrinsically resistant to extreme environments and antimicrobial treatments. Their resilience is explained by unique cellular structures formed by a complex developmental process often initiated in response to nutrient deprivation. Although the macromolecular structures of spores from different bacterial species are similar, their resistance to environmental insults differs widely. It is not known which of the factors attributed to spore resistance confer very high-level heat resistance. Here, we provide conclusive evidence that in Bacillus subtilis, this is due to the presence of a mobile genetic element (Tn1546-like) carrying five predicted operons, one of which contains genes that encode homologs of SpoVAC, SpoVAD and SpoVAEb and four other genes encoding proteins with unknown functions. This operon, named spoVA, confers high-level heat resistance to spores. Deletion of spoVA in a B. subtilis strain carrying Tn1546 renders heat-sensitive spores while transfer of spoVA into B. subtilis 168 yields highly heat-resistant spores. On the basis of the genetic conservation of different spoVA operons among spore-forming species of Bacillaceae, we propose an evolutionary scenario for the emergence of extremely heat-resistant spores in B. subtilis, B. licheniformis and B. amyloliquefaciens. This discovery opens up avenues for improved detection and control of spore-forming bacteria able to produce highly heat-resistant spores.

Specific amino acids, purine ribonucleosides, or a combination of the two is required for efficient germination of endospores of Bacillus cereus ATCC 14579. A survey including 20 different amino acids showed that L-alanine, L-cysteine, L-threonine, and L-glutamine are capable of initiating the germination of endospores of B. cereus ATCC 14579. In addition, the purine ribonucleosides inosine and adenosine can trigger germination of the spores. Advanced annotation of the B. cereus ATCC 14579 genome revealed the presence of seven putative germination (ger) operons, termed gerG, gerI, gerK, gerL, gerQ, gerR, and gerS. To determine the role of the encoded putative receptors in nutrient-induced germination, disruption mutants were constructed by the insertion of pMUTIN4 into each of the seven operons. Four of the seven mutants were affected in the germination response to amino acids or purine ribonucleosides, whereas no phenotype could be attributed to the mutants with disrupted gerK, gerL, and gerS loci. The strain with a disrupted gerR operon was severely hampered in the ability to germinate: germination occurred in response to L-glutamine but not in the presence of any of the other amino acids tested. The gerG mutant showed significantly reduced L-glutamine-induced germination, which points to a role of this receptor in the L-glutamine germination signaling pathway. gerR, gerI, and gerQ mutants showed reduced germination rates in the presence of inosine, suggesting a role for these operons in ribonucleoside signaling. Efficient germination by the combination of L-glutamine and inosine was shown to involve the gerG and gerI operons, since the germination of mutants lacking either one of these receptors was significantly reduced. Germination triggered by the combination of L-phenylalanine and inosine was lost in the gerI mutant, indicating that both molecules are effective at the GerI receptor.

The food-borne pathogen Listeria monocytogenes has the ability to survive extreme environmental conditions due to an extensive interacting network of stress responses. It is able to grow and survive at relatively high temperatures in comparison with other non-sporulating food-borne pathogens. To investigate the heat-shock response of L. monocytogenes, whole-genome expression profiles of cells that were grown at 37 6C and exposed to 48 6C were examined using DNA microarrays. Transcription levels were measured over a 40 min period after exposure of the culture to 48 6C and compared with those of unexposed cultures at 37 6C. After 3 min, 25 % of all genes were differentially expressed, while after 40 min only 2 % of all genes showed differential expression, indicative of the transient nature of the heat-shock response. The global transcriptional response was validated by analysing the expression of a set of 13 genes by quantitative PCR. Genes previously identified as part of the class I and class III heat-shock response and the class II stress response showed induction at one or more of the time points investigated. This is believed to be the first study to report that several heat-shock-induced genes are part of the SOS response in L. monocytogenes. Furthermore, numerous differentially expressed genes that have roles in the cell division machinery or cell wall synthesis were down-regulated. This expression pattern is in line with the observation that heat shock results in cell elongation and prevention of cell division.

The SOS response is a conserved pathway that is activated under certain stress conditions and is regulated by the repressor LexA and the activator RecA. The food-borne pathogen Listeria monocytogenes contains RecA and LexA homologues, but their roles in Listeria have not been established. In this study, we identified the SOS regulon in L. monocytogenes by comparing the transcription profiles of a wild-type strain and a DrecA mutant strain after exposure to the DNAdamaging agent mitomycin C. In agreement with studies in other bacteria, we identified an imperfect palindrome AATAAGAACATATGTTCGTTT as the SOS operator sequence. The SOS regulon of L. monocytogenes consists of 29 genes in 16 LexA-regulated operons, encoding proteins with functions in translesion DNA synthesis and DNA repair. We furthermore identified a role for the product of the LexA-regulated gene yneA in cell elongation and inhibition of cell division. As anticipated, RecA of L. monocytogenes plays a role in mutagenesis; DrecA cultures showed considerably lower rifampicin-and streptomycin-resistant fractions than the wild-type cultures. The SOS response is activated after stress exposure as shown by recA-and yneApromoter reporter studies. Stress-survival studies showed DrecA mutant cells to be less resistant to heat, H 2 O 2 and acid exposure than wild-type cells. Our results indicate that the SOS response of L. monocytogenes contributes to survival upon exposure to a range of stresses, thereby likely contributing to its persistence in the environment and in the host.