A B S T R A C T Changes in the pulp during ripening and post-harvest storage of cocoa pods were determined during numerous harvests in Malaysia (1984Malaysia ( to 1987 and Ghana (1985Ghana ( to 1986
Ubiquitin, a highly conserved 76-amino-acid protein, is involved in the response of many types of eukaryotic cells to stress but little is known about its role in lower plants. In the present study we have investigated the distribution of ubiquitin in the unicellular alga Chlamydomonas reinhardii as well as the effect of heat and light stress on its conjugation to cellular proteins. Immunoelectron microscopy shows that ubiquitin is located in the chloroplast, nucleus, cytoplasm, pyrenoid and on the plasma membrane. The location of ubiquitin within chloroplasts has not been observed previously. In immunoblots of whole cell extracts with an antibody to ubiquitin a prominent conjugate band with an apparent molecular mass of 29 kDa and a broad region of high-molecularmass conjugates (apparent molecular mass > 45 kDa) were observed. Exposure of cells to a 41.5 "C heat shock in both the dark and light caused the disappearance of the 29-kDa conjugate and an increase in the high-molecularmass conjugates. After step down to 25 "C the 29-kDa conjugate reappeared while the levels of high-molecularmass conjugates decreased. In light, the recovery of the 29-kDa band was more rapid than in the dark. Photoinhibition alters the ubiquitin conjugation pattern similarly to heat shock, but to a lesser degree. These observations imply that, in Chlamydomonas, ubiquitin has a role in the chloroplast and in the response to heat and light stress.Ubiquitin is involved in a number of basic cellular functions in eukaryotic cells which include intracellular protein degradation, response to stress, the cell cycle and DNA repair (see [l -31 for reviews). In higher plants many components of the ubiquitin system have been identified, but their functions are not as well understood as those of their counterparts in mammalian cells or yeast [4, 51. Little is known about the ubiquitin system of lower plants. Recently the sequence of a ubiquitin extension protein from the unicellular alga, Chlamydomonas reinhardii, has been described and its ubiquitin moiety found to differ by only one amino acid residue from that of higher plants [6].Part of the ubiquitin in the cell is found as the free molecule and part of it is linked covalently to other proteins [7]. In mammalian cells ubiquitin is found in various cell compartments which include cytoplasm, nucleus, lysosomes and autophagic vacuoles [8]. On the plasma membrane ubiquitin is linked to certain hormone receptors [9, 101 and to a lymphocyte homing factor [ll]. Ubiquitin has also been found to be associated with cytoskeletal elements of mammalian cells such as microtubules [12], actin [13] and cellular inclusions associated with neurological diseases [14, 151. Immunoelectron microscopy of oat coleoptiles exposed to red light has revealed ubiquitin in both the cytoplasm and the nucleus as well as in dense bodies containing the Pfr form of phytochrome [16 -191. Ubiquitin has also been found to be conjugated to plant viral coat protein subunits [20].The involvement of ubiquitin in the response of euka...
Ubiquitin is one of the most highly conserved proteins known. To determine whether algal ubiquitin is identical to higher plant ubiquitin, three ubiquitin cDNAs were identified from a Chlamydomonas reinhardii cDNA expression library acreened with human ubiquitin antibodies. The cDNAs encode a 76 amino acid (aa) ubiquitin monomer with an extension protein of 52 aa. The DNA and derived aa sequence of one is shown below and the aa sequence is compared to ubiquitin 52 aa extenpion proteins from Arabidopsis (1), yeast (2) and human (3). Arrowhead marks the ubiquitin extension junction and dashes denote aa identity. Chlamydomonas ubiquitin has only 1 aa substitution from the higher plant sequence (position 24) and 2 from the animal sequence (positions 19 and 57). The Chlamydomonas 52 aa extension protein is also highly conserved, being 86% and 81% identical to its counterparts from Arabidopsis and yeast, respectively. Both the positions of 4 cysteine residues (circles) and the nuclear localization signal (underlined) are conserved among extensions. GGGCAGCCATGCAAATCTTCGTGAAGACCCTCACGGGTAAGACCATCACCCTCGAGGTGGAGTCTTCGGACACCATCGAG 80MetGlnIlePheValLysThrLeuThrGlyLysThrIleThrLeuGluValGluSerSerAspThrIleGlu
The multiple biological functions of the small polypeptide ubiquitin are mirrored by its unparalleled conservation on the amino acid and gene organization level. During the last years, it has become widely accepted that ubiquitin is an essential component in the ATP‐dependent nonlysosomal protein degradation pathway occurring in all eukaryotic organisms. As turnover, consisting of protein synthesis and disassembly, is a central and vital process for each living cell, ubiquitin‐mediated proteolysis is of enormous physiological value. The components of the ubiquitin ligation system have been characterized skillfully in plant and animal cells, but at the moment many questions remain as to how the high degree of specificity that is necessary for the regulation of intracellular breakdown is ensured. The recent hypotheses and models proposed for the basic mechanisms of protein recognition, conjugation and degradation will be discussed in detail. The existence of ubiquitin‐protein conjugates which are not rapidly degraded clearly suggested that the role of ubiquitin is not restricted in its implication for protein turnover. Alterations of DNA structure, specific cell recognition mechanisms and cytoskeletal variations were observed as further ubiquitin‐dependent processes which are not directly coupled to protein degradation.
A detailed characterization of Chlamydomonas reinhardii cDNAs encoding ubiquitin 52‐amino‐acid fusion proteins is presented in this study. While two cDNAs (designated UBI1 and UBI3) encode the complete ubiquitin extension protein, the third one (UBI2) lacks a minor part of the 5′ region as well as a poly(A) tail. Differences between UBI1 and UBI3 are observed in the length of the poly(A) domain (13 versus 46 adenines) and in the lack of three nucleotides at the 3′ noncoding region of UBI3. According to Northern blot experiments using UBI1 as a homologous probe, at least six members of the C. reinhardii ubiquitin gene family are transcriptionally active at regular conditions. During application of severe stress (heat shock in light and darkness, and photoinhibition), the transcription of the UBI1 mRNA substantially decreases. This effect is most drastically induced by application of heat shock to illuminated cells.
scite is a Brooklyn-based organization that helps researchers better discover and understand research articles through Smart Citations–citations that display the context of the citation and describe whether the article provides supporting or contrasting evidence. scite is used by students and researchers from around the world and is funded in part by the National Science Foundation and the National Institute on Drug Abuse of the National Institutes of Health.
hi@scite.ai
10624 S. Eastern Ave., Ste. A-614
Henderson, NV 89052, USA
Copyright © 2024 scite LLC. All rights reserved.
Made with 💙 for researchers
Part of the Research Solutions Family.