No abstract

We characterized the conformational preferences of DNA in an equimolar mixture of complementary G-rich and C-rich strands from the promoter region of the c-MYC oncogene. Our CD-based approach presupposes that the CD spectrum of such a mixture is the spectral sum of the constituent duplex, G-quadruplex, i-motif, and coiled conformations. Spectra were acquired over a range of temperatures at different pHs and concentrations of KCl. Each spectrum was unmixed in terms of the predetermined spectra of the constituent conformational states to obtain the corresponding weighting factors for their fractional contributions to the total population of DNA. The temperature dependences of those contributions then were analyzed in concert according to a model based on a thermodynamic representation of the underlying equilibria. Fitted estimates of the melting enthalpy and temperature obtained for the duplex, G-quadruplex, and i-motif imply that the driving force behind dissociation of the duplex and the concomitant formation of tetrahelical structures is the folding of the G-strand into the G-quadruplex. The liberated C-strand adopts the i-motif conformation at acidic pH and exists in the coiled state at neutral pH. The i-motif alone cannot induce dissociation of the duplex even at pH 5.0, at which it is most stable. Under the physiological conditions of neutral pH, elevated potassium, and room temperature, the duplex and G-quadruplex conformations coexist with the C-strand in the coiled state. Taken together, our results suggest a novel, thermodynamically controlled mechanism for the regulation of gene expression.

We used the intestinal segregated flow model (SFM) versus the traditional model (TM), nested within physiologically based pharmacokinetic (PBPK) models, to describe the biliary and urinary excretion of morphine 3b-glucuronide (MG) after intravenous and intraduodenal dosing of morphine in rats in vivo. The SFM model describes a partial (5%-30%) intestinal blood flow perfusing the transporter-and enzyme-rich enterocyte region, whereas the TM describes 100% flow perfusing the intestine as a whole. For the SFM, drugs entering from the circulation are expected to be metabolized to lesser extents by the intestine due to the segregated flow, reflecting the phenomenon of shunting and route-dependent intestinal metabolism. The poor permeability of MG crossing the liver or intestinal basolateral membranes mandates that most of MG that is excreted into bile is hepatically formed, whereas MG that is excreted into urine originates from both intestine and liver metabolism, since MG is effluxed back to blood. was better predicted by the SFM-PBPK (2.59 at 4 hours) and not the TM-PBPK (1.0), supporting the view that the SFM is superior for the description of intestinal-liver metabolism of morphine to MG. The SFM-PBPK model predicts an appreciable contribution of the intestine to first pass M metabolism.

G-quadruplexes and i-motifs are noncanonical secondary structures of DNA that appear to play a number of regulatory roles in the genome with clear connection to disease. Characterization of the forces stabilizing these structures is necessary for developing an ability to induce G-quadruplex and/or i-motif structures at selected genomic loci in a controlled manner. We report here the results of pH-dependent acoustic and densimetric measurements and UV melting experiments at elevated pressures to scrutinize changes in hydration and ionic atmosphere accompanying i-motif formation by the C-rich DNA sequence from the promoter region of the human c-MYC oncogene [5'-d(TTACCCACCCTACCCACCCTCA)] (ODN). We also conducted pH-dependent acoustic and densimetric characterizations of two DNA molecules that are compositionally identical to ODN but do not adopt the i-motif conformation, 5'-d(CTCTCACCACACCACACCTCTC) (ODN1) and 5'-d(CACACTCCTCACCTCTCCACAC) (ODN2). Our results reveal that i-motif formation by ODN is not accompanied by changes in volume and compressibility. The volumetric similarity of the i-motif and coil states of ODN implies a fortuitous compensation between changes in the intrinsic and hydration contributions to volume and compressibility. Analysis of the pH-dependent volumetric profiles of ODN, ODN1, and ODN2, along with the data on volumetric changes accompanying the protonation of isolated cytosine and deoxycytidine, suggests that protonation of the cytosines in the oligonucleotides causes release of the majority if not all of their counterions to the bulk. Thus, in the i-motif conformation, the oligomer no longer acts as a polyelectrolyte insofar as counterions are concerned. We discuss the biological ramifications of our results.

The denaturing or stabilizing influence of a cosolvent on a protein structure is governed by a fine balance of the energetics of the excluded volume effect and the energetics of direct protein-cosolvent interactions. We have previously characterized the energetic contributions of excluded volume and direct interactions with urea for proteins and protein groups. In this work, we examine the molecular origins underlying the relatively weak temperature and urea dependences of the m-values of globular proteins. Our combined experimental and computational results collectively paint a picture in which the relative independence of protein m-values of urea concentration originates from fortuitous compensatory effects of a progressive increase in the solvent-accessible surface area of the unfolded state and a slightly higher urea binding constant of the unfolded state relative to the folded state. Other denaturing cosolvents which lack such a compensation make poor candidates for linear extrapolation model-based protein stability determination studies. The observed diminution in m-values with increasing temperature reflects, in addition to the aforementioned compensatory effects, a decrease in protein-urea binding constants with temperature in accordance with the negative sign of the binding enthalpy.